Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig1
Contig Information
Length 809 bp
Tissue Seed DPA5
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhok9b20   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 972
Evalue 1.96533e-103
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig1
ATAATCCACTTGATGGTTCCACGAATGTCAACTCGCACAGAATAACCCTGACCACTCGTACCAAAACACACCGCAACCCAGTCTCAGATAACATAGGACA
CACATAATAACTAAGAAGCAGGCTTCACCGCCTCTGCAACAGATCATCGACTCATTTAGTCGACCTCCTCGATCTTGTCGTCCGCTGGCAGCTTGGAGGC
AATCTTCTCATCCTTGATGGTGTTGCGCATGTTGTAGGAGTAGTTCTCCAGGGCGTTCTTTGACTCCACCTTCTTCTTGTGCTCCTCATCCTCAGACTTG
TACTTCTCAGCCTCCTGGACCATCTTCTCAATCTCCTCCTTGCTCAGCCTGCCCTTGTCGTTGGTGATGGTGATCTTGTTCTTCTGCCCAGTCGTCTTGT
CCTCGGCAGACACGTTCAGGATACCATTGGCATCAATGTCAAAGCAGACAGTGATCTGGGGAACTCCCCTGGGTGCAGGAGGGATGCCGGACAGCTCGAA
CTTGCCAAGGAGGTTGTTGTCACGGGTCCTGGTCCTCTCACCCTCGTACACCTGGATGAGCACACCAGGCTGGTTGTCCGAGTAGGTGGAGAAGACCTGC
TCCTTCTTGGTGGGGATGGTGGTGTTCCTTGGGATCAAGACCGTCATCACACCCCCGGNCGTCTCCANACCAANANAAAGAGGAGTGACATCCAACANCA
NCANGTCCTGGACCTTCTCNTTGCCCTCTCCACTCAANATGGNANCCTGGACANCANCTCCATANGCAACANCCTCATCANGGNTGATGCTCTTGCANAN
CTCTTTGCC
page-top