Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2765
Contig Information
Length 672 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 30 Clones [Download: CSV  ,  FASTA ]
whms10a03    whms10a05    whms10a06    whms10a17    whms3c11    whms5i13    whms5i14    whms6m15    whms9a18    whms9f19    whms9o06    whms9o19    whms11o12    whms11p23    whms15m14    rwhms10a03    rwhms10a05    rwhms10a06    rwhms10a17    rwhms10k11    rwhms10k12    rwhms3c11    rwhms5i13    rwhms5i14    rwhms6m15    rwhms9f19    rwhms9o06    rwhms9o19    rwhms11p23    rwhms15m14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit metallothionein [Triticum aestivum]
Score 271
Evalue 2.63087e-22
Total Hit Count 340
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2765
CGGCACGAGGTGCAGATCGGATCAGACCAGAGACACAGAGCAGAGCGGATAAACTCGAGGGCAGTAGATCATCACCAACCATGTCGTGCTGCGGAGGCAA
CTGCGGGTGCGGATCCGGCTGCAAGTGCGGCAACGGCTGCGGAGGGTGCAAGATGTACCCTGAGATGGACGAGGGGGTGACCACCACCTCCCAGACCCTC
ATCATGGGCGTCGCCCCCTCCAAGGGCACCCCGTCGTTCGAGGCCGCCGCCGAGACCGGAGCCGACAACGGCGGGTGCAAGTGCGGCTCCAACTGCACCT
GCAACCCGTGCACCTGCAAGTGATCCATCAAATCAGGACAAGGAGATGGCATGGCATGGATGGACCTAATGAAGGAGCACTAGTAGTAGTTATGCATGGT
GTGTGCGTTTGTGTTCTCTTTTTAATTGCCGCCGAGAATAAGACGAGATCTATCGTATCGTATCGTATCGTATCGAGCTAGTTCATGGCCCCTTGTGGCT
TGTAGCCGTGTGGTGTGCAAGGCGCGCGTACGTCCTGTGTCTGTGACGCGCCTTTTCCTACTGTTCTAAGCTCCGTCCCGTGCCTTCCCGTTTTATCTAC
ATATATGTAGACAACAATAATTTGGAGTTTCTCTCTATGTATGCATGTGTATCTGTATCACTAAAAAAAAAA
page-top