Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2757
Contig Information
Length 1265 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 20 Clones [Download: CSV  ,  FASTA ]
whms10a11    whms5f15    whms5m20    whms5n07    whms5n08    whms5n19    whms6e19    whms15n10    whms15p22    whms19a07    rwhms10a11    rwhms5f15    rwhms5m20    rwhms5n07    rwhms5n08    rwhms5n19    rwhms6e19    rwhms15n10    rwhms15p22    rwhms19a07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 14-3-3 protein homologue [Hordeum vulgare subsp. vulgare]
Score 1308
Evalue 4.36369e-142
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2757
TAGACAAGAAAAACTCAGTTGTTGCTTCATAAGAAAGGCAAGCTTTGGGGGTGCTTGACGCCAAGTATGATCAATCATCAACAAGCCATGAAAATTGCTA
ATACAGCAATACTAATAATGTGCTGCAATACAGGAAATAGTTTGAAATCTGCTAATGAACTAAGAAGCGACGATGTCCACATGACCGTCCTCATGACTGT
AGTCCACTAGGTACTTCAGCTCGACACGCTTCGCATAGCACCATCCTACCACATCTTATGATTCACATAGTGCAACCGACCCTAGTACATCTTATGATCC
GAATGATACAGGTAGCTGCGTAAATGGACTCAGAAATAAACTTGGGCACGCTCGAGGGCCAATCAGTGCCCCTCTCCCTCAGGCTTTGAGGCGGCTTCCT
TGATCTCATCACCACCCTCCTCTGCGTTATCGGAGGTCCAGAGAGTCAAGTTGTCACGAAGAAGTTGCATGATCAAGGTGCTGTCCTTGTAGGATTCCTC
GCCGAGGGAGTCCAGCTCAGCAATAGCTTCATCAAATGCCTGCTTGGCAAGGTTGCAAGCACGGTCTGGAGAGTTCAGGATCTCATAGTAGAACACTGAG
AAGTTGAGTGCAAGTCCAAGCCTTATCGGGTGGGTGGTAGGCAAGTCAGCAAGCGCGATGTCCTGGGCTGACTTGTATGCTACAAGAGTGTTCTCAGCTG
CTTCTTTCCTCTCAGCGCCTGCCTTGAACTCCGCAAGGTACCTGTGGTAGTCACCCTTCATTTTCAGATAGAACACCTTGGACTCTGCTGCAGTGGCAGA
GGGGACAAGGTGGGAGTCCAGAAGCTTGAGGATGCCATCACAGATCTTGCTGAGCTCAGTTTCAATCCTGGTACGGTACTCCTTGATTGAAGCAACATAG
GCCTCGTTCCCACGGCTCTCCTCCTTCTGCTCAATGGAGGAGATGATCCTCCAGGAAGCCCTCCGGGCACCAATCACATTCTTGTAAGCAACAGAGAGCA
GGTTGCGCTCCTCAACAGTGAGCTCACCAACATCAGCGGTCTTTGCCACCTTCTCCATGAACTCAACCATTTCTTCGTAACGCTCAGCCTGCTCGGCAAG
CTTGGCCATGTACACATTCTCCTCACGGGTTGCCTCAGCGGTAGACATTTTCCCTCTTCTTTGTTGCAAACTAGTTCAGTGCCTTTCCTCTCGCGCTTCG
CTTTTCTCACGGGCTTCGGCTGCGGATCTCGGGAGCGCGCTGTGGGTTCGTGGGGGGCGGGGGGG
page-top