Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2743
Contig Information
Length 820 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 15 Clones [Download: CSV  ,  FASTA ]
whms10e17    whms2m06    whms9c14    whms9k09    whms11l12    whms12f01    whms20d09    rwhms10e17    rwhms2m06    rwhms2m17    rwhms9c14    rwhms9k09    rwhms11l12    rwhms12f01    rwhms20d09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cyclophilin A-1 [Triticum aestivum] >gi|13925737|gb|AAK49428.1|AF262984_1 cyclophilin A-3 [Triticum aestivum] >gi|156193317|gb|ABU56010.1| cyclophilin 5 [Dasypyrum villosum]
Score 843
Evalue 1.83836e-88
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2743
TCATTCAAACGGTAAGATAGCAGCAGACACAGGAAGATAACCAAGGCGGCCGGACAGAGATCCAGCAGCCCAAAGAGTCCACCTAAAACCCTCCTAAACC
AACCACGGAGATCTCATCGGACGGACCAGGGGAAGACACGACACGACACACGACTCTCTTATTTAGATCGACGACACGACACGGGACACACGGGGCGGCG
ACGACGACGGCGAAAGGCGACCCGCGCGCGGGCGGATCTAGAGCTGGCCGCAGTCGGCGATGACCACCTGCTTGGAGCAGGTGCCGCTGCGGGAGCCCAC
CTTCTCGATGTTCTTGACGACGTCCATGCCCTCGACGACCTCGCCGAAGACCACGTGCTTGCCGTCGAGCCAATTGCAGGGGACGGTGCAGATGAAGAAC
TGGGAGCCGTTGGTGTTGGGCCCCGCGTTGGCCATGGAGAGGATCCCGGGCTTGGTGTGCTTGTGGACGAACTTCTCGTCGGCGAACTTCTCGCCGTAGA
TGGACTCGCCGCCGGTGCCGTTGCCCCGGGTGAAGTCGCCGCCCTGGCACATGAAGTCGGGGATCACGCGGTGGAAGGCGCTGCCCTTGTAGTGCAGCGG
CTTGCCGCTCTTGCCGACGCCCTTCTCGCCGGTGCACAGCGCGCGGAAGTTCTCCACCGTCCGCGGCACCGCGTCCTTGTACAGCTCCATCACGATGCGC
CCGGCCGGCGCGCCGCCGACGGTCATGTCGAAGAACACCCTCGGGTTGGCCATCTCGCTCGCCGGGATCGGGGATGAGGGCTAGGGTTTTGAGATGGGGA
TTTCTGTGGGGATTGGATAC
page-top