Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2739
Contig Information
Length 809 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 15 Clones [Download: CSV  ,  FASTA ]
whms10a20    whms2i11    whms15c18    whms17d14    whms18e06    whms18e17    whms18j06    rwhms10a20    rwhms2i11    rwhms15c18    rwhms17d14    rwhms18e06    rwhms18e17    rwhms18e18    rwhms18j06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195623990|gb|ACG33825.1| 60S ribosomal protein L12 [Zea mays] >gi|195637596|gb|ACG38266.1| 60S ribosomal protein L12 [Zea mays] >gi|195639366|gb|ACG39151.1| 60S ribosomal protein L12 [Zea mays]
Score 791
Evalue 1.91243e-82
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2739
TTTTTTTTTTGACAAAACTCAACATATGATATTCTAGCTGCCATAATAACATTGATTGATTCCGCAAGGGTACTCATTAAACCAGTAAAAAATAGTCTCA
CAATGGAACCACTAAAGCATGACAAAAGTTTCTTCTTCAGCACGAGTAGAACAAGTGAAGATATCACATCCATTCTCTCAACTGCATCAGGAAGCATCTA
GATAGGAGAAACTACTTCAGCAGCCTCACATAACAACCTGCCCAAAGCCAAGCCTTCTTAAGCGGGGATCTCCACCTCGCCGTCGTCGATCTCCGTCTGC
AGATCCTTGGGGTCCTTGCCGTCAACGGTGCAGCCGACGCTGACGCAGGTGCCGAGGATCTCCTTGACGGTGCCGGCCATCTCCTTGGCCATGGAGCGGA
CCTTCATGATCTTGGCGATCTCGATGACGTCGTCGAGGCTGATGTTGCCGCTGTGCTTGATGTTCTTGACCTTCTTGCGGTCCCTCTCGGGCTCCTTGAG
CGCCTTGATGACGAGGGCTGCGGCGGAGGGGACGACGGACACCTTGGCCTGGCGATTCTGGACGGTGAGCTTGACGGTGACGCGGAGGCCCTTCCAGTCC
TTGGCCGTCTCCTTGGCGATGTCTTCTCCGATCTTCTTTGGGGAGAGACCGAGCGGGCCGATCTTGGGGGCCAGGGACGACGCAGCGCCGACCTCCCCGC
CGGTGACGCGGACATACACCTCCACGATCTGGGACGGGTCGAGCTTGGGAGGCATGGCTGCGAGCTTGGGCTGGGGAGGATTGGCTGTGGGGAGTGTGTG
GCGGCGGCT
page-top