Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2737
Contig Information
Length 664 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 15 Clones [Download: CSV  ,  FASTA ]
whms10a08    whms10j04    whms3j10    whms4g07    whms6p10    whms17p11    whms8c16    rwhms10a08    rwhms10j04    rwhms3j10    rwhms4g07    rwhms8c16    rwhms11m03    rwhms12k10    rwhms17p11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Babesia bovis T2Bo] >gi|154796873|gb|EDO06053.1| hypothetical protein BBOV_II000930 [Babesia bovis]
Score 82
Evalue 2.0973
Total Hit Count 3
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2737
TTTTTTTTTTGAACACCACAACAGATTAACAACACGGCTGAATATAGATCTCTGATAACAACAGATAAGAGTGGCGATAGAATGCCCTTACATCCCACAT
GCAACCACCGAAATTAGATCCCACAGAACCTGGATCCCCATTGTACATACAGTAGTGATCTTACATAACACACAAGCCAGGAATTACAGAGTACACCGGC
TAGTTAAAACATGCATGATATATAGAGTACTAGTAGATAGTAGAACTTGCAGGTGCAGTAGTAGATAGTAGAACATGCGGTGCAGGATAGATATTCCAGT
CATTCACCATTGAGCCATCTCCCTTCAACCGAGCCTATGGACCCCAAGCAAAAAGGTGAGTGCTCCAAGACTGAAGCCAGCACCACAGGCTAAGGCCTCG
TCCCTGCGCCTCTTCCTGTGTTTCTCTACAATCTTGTCCAGTGCCCGGCGAAACTCTGGGCCGAAGCCGAAGCGGTCGAAGTCAGCATCAGCAGGTGCCG
GAGCACGAGAAGAGACGCGAACCCGCTGGACAGCGGCGGGGATCTTCTGCTTCAGCTTGGCGGCCATGGTGCGCAGCGCCATAGCCATACCCTCCACCAA
CCCAAGCAGATCTGGACGACGGCGGCTAGGGTTTCCTTCTCTCGATCTCCAACACGCGAGCGAT
page-top