Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2734
Contig Information
Length 898 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 14 Clones [Download: CSV  ,  FASTA ]
whms10b06    whms12m17    whms13m22    whms8j07    whms8k07    whms19k05    rwhms10b06    rwhms7m12    rwhms8j07    rwhms8k07    rwhms12m17    rwhms13m22    rwhms18o17    rwhms19k05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal subunit 8E protein [Brachypodium sylvaticum]
Score 841
Evalue 3.67822e-88
Total Hit Count 430
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2734
TAGAATCTGGATAGCTTTAGATCACAACCAAAACAGGGAAAAACATTCTCAGTTCAACCTAGGACTCGAACAGTTTACAGAAAATGGTGTTCAGTATGTC
TGCAAACATGACATGGACGCAACATCTAAGAAAATCCAACAAGTAACATGCAGCAGCTCTTCAGCCTAAGCTGTGGCACCCTTGCCCTTCTTCTTCTGGA
GCTTCCTCATGTAGAACTCCAGCTCCTTGCCCTCCAGGATGTACCCATCAGCTCTGCCACACTGTCCAGGGCGAGACGAAATGCAGGCCAGCAGCCTTCC
ACCGCTGAACTGCTCCTCAATGTGAGAGTCCAGTGTACGTCCCTGCTGGCGCTTCTCAAGCTTCCTCTGGACATTGTTGCTCTTCTTTGCTTCCTCTGTG
GCAGCAGCAGCAACCTCAGACTCTTGTCCCTCAGCAGCATCCTTCTTGGCAGCTGCAGCAGCTTTCTTCTTCCTACCGATTTCCACTCCATAATGAGTCA
GGTACCACTGCTTGAAAGGGGCAGCATCAACTTGCACAATGGCATTCTTGACAAGGGTCTGAGTCCTCACAAGCTCATTGTTTGACGAATTGTAAACCAC
ATCCAGGAGACGGGTCTTGCGGGTCACAGCCTCACTACCCCATGAGAAGTTACCAGTGTCCAGACGGAGAGCCCTCCACTTCACGTTACCTCCGCGAACA
CGGACCCTCCTCACTGTCTTGTTGCTCGAAAGCTTAGTGTTGGCTGGCTGGCGGCCGAGCTCATACTTTCGCTTCTTCCTCCACGCCTTCTGCTTCCCAC
CGGTGGCCCGGCGCTTGTGCATGGAGTCACGCGAGATACCCATGGTGGCGTCGGTGGCTTGGCTCCGCTGCTGCTTCGCCTCCTATGCGCGCGCCGCC
page-top