Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2720
Contig Information
Length 624 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 13 Clones [Download: CSV  ,  FASTA ]
whms10b23    whms1b05    whms3o11    whms4f12    whms17b04    whms8h24    rwhms10b23    rwhms10l24    rwhms1b05    rwhms3o11    rwhms4f12    rwhms8h24    rwhms17b04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 193
Evalue 2.45669e-13
Total Hit Count 58
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2720
TTTTTTTTTTGCAGGCAAACAAAGAATTAGGCACACCAAGTTTTGAGATGAACAAGATTAGTTTGAAAGCGACAGGTTTTAGGCAAGCTGGCTTCCAAGC
AGGAGGTCAGCCTGGACACAATGAACCATACAGACAGAGTACATCGACGCAGGTGGTAAACTGCTGAAACCAAACACTTCCAGTTTTCACCACATGGATA
ACAGAGATACAGGCCAATTCATCGTTCGTTCATTAAGCAGCATCATTAACATCACTTTCCGCCAAACAAGTAGCCCAGGGAGGAGCCACCGCCAGGAGCA
GCATGAACCTTGGTTGAAGGACGGTCCGTAAGGAAGTTGCCCGTGTTCTGGCCATCTGCACGGTAGTAGTTGTTCGCCCGGCTACCTGGAATGCCAGCTG
GAATCTGCTTGGCTACATCAGCAGCTGCCGGTGCTGGTTTCTCAGCAGGTGCGGGCTTCGCAGCTGGTGCTGCAGCGGGCTTTGCAGGCTCACCATCTCC
AAACAGGTAACCCAGAGAACTTTGACCACCACCAGCACTCCCGCCACGACTCATCTTGACTTAGATCGGGCGCCGACGAGGGGACGGGGGGCGAGGGCGA
GACAGGAGGAGGCGCTCGAAGTGG
page-top