Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2716
Contig Information
Length 1069 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 13 Clones [Download: CSV  ,  FASTA ]
whms10g03    whms10g04    whms4k15    whms4k18    whms7c11    whms7o08    whms18k13    rwhms10g03    rwhms10g04    rwhms4k15    rwhms4k18    rwhms7c11    rwhms7o08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare] (no hit)
Score 2262
Evalue 0
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2716
TCGAGCGAGCGAGAAATCCCCAATCCCCACCAAACCCTAACCCAAACCCTAACCCTGATTGAAACGACCAGGAGAGGAGAGGAGAGGAGCGGATCCGGCG
ATGGCCGTCGAGAAGATGCACTTGTCCATGCCGTTGCCCGCCGGCTTGGAGGGTTTCCCCTTCACCACGTTCCAGGCGGAGCTGGAGGCCTTCACCGTCA
AGTTGAGGGCGGAGGCGAAGAAGGCCAAGGCCCAAGCCGGAGGTCAAGGAGGCCAAGGCCAAGGAGGAGAAGGCCAAGCCGGAGGTCAAGGCCAAGGTGA
AGAAGGCCAAGGCGAAGGAGGCCAAGCCGGAGGTCGAGGCCAAGGCAAAGGAGGCCAAGCCGGAGGTTAAGGCCAAGGCGAAGGAGGCCAAGGCGAAGGA
GGCCAAGCCGGAGGTCGAGGCCAAGTCAAAGGAGGTCAAGGCCAAGGTGGAGTTGAGGACCCTCACCAAGGAGGAGGAGGAGGCGCTCATCAAGTTCGTG
GCGCTGCTGGAGAAGGAGGAGGACTTCCTCGACGCCAAGGCGGAGGCGGAGAAGGAGGCGGAGAAGTGTGGCTCCAAGAGGAAGGTGGAGTTGGAGCGGG
ATGAGGAGGGGGCAGCGTTCCTGGCGTGGATCGAGTCCACCAAGCCACAGACGGACCAAGTGGATTACTCGGATGGGGATGTGTCGGACGGCTACCACTC
GCAGGACGACAACATCGGCAGCGACGGCAGGGTCATGTCGCGGTATGAGCGCCATGTTCAGGCCAACAACGCTCGCTGTCCTTTCTTGGTGGGGGCCTAA
TCCCATCCACGACGGTGCTCTTGCTCTTGTGGTCTGAGAAGCTGACGAGGAGCTTCGCCATTGCTATCCCATCTAGTACCAACCATGTATCTATCTTATC
TATCTATATTTCTAGTTGATCCTGTGGACATATATATGTGGGATTGATCCGCCTACCCTGATGCTATTGTTGCGCACCGATGAAGCAATGTCATTGTGAG
ACTGATAATCTATCGAGTACTAGTAGTATCTAGTATATGTTAAATCTACTGGTGTTATGCCCTTCGTAT
page-top