Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2711
Contig Information
Length 941 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 12 Clones [Download: CSV  ,  FASTA ]
whms10d16    whms2e16    whms2i05    whms11g08    whms16b03    whms16b05    rwhms10d16    rwhms2e16    rwhms11g08    rwhms14l22    rwhms16b03    rwhms16b05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0489600 [Oryza sativa (japonica cultivar-group)] >gi|1703380|sp|P51823|ARF2_ORYSJ RecName: Full=ADP-ribosylation factor 2 >gi|1132483|dbj|BAA04607.1| ADP-ribosylation factor [Oryza sativa Japonica Group] >gi|13646976|dbj|BAB41081.1| ADP-ribosylation factor [Triticum aestivum] >gi|23304413|emb|CAD48129.2| ADP-ribosylation factor 1-like protein [Hordeum vulgare subsp. vulgare] >gi|50511366|gb|AAT77289.1| ADP-ribosylation factor [Oryza sativa (japonica cultivar-group)] >gi|113579443|dbj|BAF17806.1| Os05g0489600 [Oryza sativa (japonica cultivar-group)] >gi|125552797|gb|EAY98506.1| hypothetical protein OsI_20417 [Oryza sativa Indica Group] >gi|125594700|gb|EAZ34759.1| hypothetical protein OsJ_018242 [Oryza sativa (japonica cultivar-group)] >gi|215692842|dbj|BAG88186.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215695044|dbj|BAG90235.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767619|dbj|BAG99847.1| unnamed protein product [Oryza sativa Japonica Group]
Score 939
Evalue 1.70905e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2711
CTCCTCCTCCTGCCACCGATCCCGAACCAGGGAGGAACCCGGCGCGAGGAGGGCAAAGGAAGAGAAGAGGAGACCACCGAGCCCAGCGCGCGCACACGAC
AGCAGGCGCCGCGATCTCGCGCAGGAGCGGAGATGGGGCTCACGTTCACGAAGCTGTTCAGCCGGCTCTTCGCCAAGAAGGAGATGAGGATCCTCATGGT
CGGTCTCGATGCGGCTGGTAAGACCACCATCCTCTACAAGCTCAAGCTCGGAGAGATCGTCACCACCATCCCCACAATCGGGTTTAATGTCGAAACTGTA
GAGTACAAGAACATTAGTTTCACCGTTTGGGATGTCGGGGGTCAGGACAAGATCAGGCCCCTGTGGAGGCACTACTTCCAGAACACCCAGGGTCTCATTT
TTGTCGTGGACAGCAATGACAGAGAGCGTGTTGTTGAGGCAAGAGATGAGCTTCACCGGATGCTGAATGAGGATGAGCTGCGTGATGCTGTGCTGCTGGT
GTTTGCAAACAAGCAAGATCTTCCTAATGCCATGAATGCTGCTGAAATCACTGACAAGCTTGGCCTGCATTCCCTGCGCCAGCGACACTGGTACATCCAG
AGCACATGTGCTACCTCTGGGGAGGGGTTGTACGAGGGCCTTGACTGGCTGTCCAACAACATTGCCAACAAGGCTTGAAGCATCTCGGCAGGGGCTTCTA
TGGATCTGGATAAGCTGGATATTCGGACTAATACTGCCTTTACGTATTATAAACTATATAGTCTTGACAGATAATGTGGGTGTTTTGGAAAGATAAAGCT
CTCTGTCAAAGAGCTAGCTATCAGATTGTTTTCGTGGGTGTTAAATTGTCCGTGGCGCTGTTTGTTTGCCCATCATGGCTTTACTATGTCCGCTCTGTAC
TCTGTACTCGCCACTCCGACAGACTTGATACATTGTAGTAT
page-top