Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2710
Contig Information
Length 1436 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 12 Clones [Download: CSV  ,  FASTA ]
whms10a04    whms4g08    whms5o13    whms9k10    whms16i11    whms16j11    whms18n10    rwhms4g08    rwhms5o13    rwhms16i11    rwhms16j11    rwhms18n10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Fructose-bisphosphate aldolase cytoplasmic isozyme; AltName: Full=Gravity-specific protein GSC 233 >gi|41398198|gb|AAS05825.1| fructose 1,6-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878379|gb|AAT85154.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|50878433|gb|AAT85207.1| putative fructose-bisphosphate aldolase [Oryza sativa (japonica cultivar-group)] >gi|125594188|gb|EAZ34247.1| hypothetical protein OsJ_017730 [Oryza sativa (japonica cultivar-group)] >gi|169244417|gb|ACA50482.1| fructose-bisphosphate aldolase [Oryza sativa Japonica Group]
Score 1112
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2710
CCACCCCAAATTCCGCTCTCGAATCTTTCCCGAGCATCGACCATGTCGGCCTACTGCGGAAAGTACAAGGATGAGCTCATCCAGAACGCTGCCTACATTG
GCACCCCTGGCAAGGGTATCCTCGCTGCTGATGAGTCCACAGGCACCATCGGCAAGCGCTTCGCCAGCATCAATGTTGAGAACGTTGAGGACAACCGTCG
TGCCCTCCGTGAGCTCCTCTTCTGCACCCCTGGTGCCCTCCAGTACCTCAGCGGTGTGATCCTCTTTGAGGAGACTCTGTACCAGAGCACCAAGGGTGGC
AAGCCCTTTGTCGACATCCTCAAGGCGGGCAATGTCCTCCCCGGCATCAAGGTGGACAAGGGTACCATTGAGCTCGCTGGAACCAACGGTGAGACCACCA
CCCAGGGCTTTGATGACCTTGGCAAGCGCTGCGCCAAGTACTACGAGGCTGGTGCCCGCTTCGCCAAGTGGCGTGCAGTCCTCAAGATCGGCGCCACCGA
GCCATCGCAGCTCTCCATCGACCAGAACGCTCAGGGTCTGGCTCGCTATGCCATCATCTGCCAGGAGAATGGTCTGGTGCCCATTGTTGAGCCTGAGATC
CTTGTTGATGGACCTCATGACATTGACCGCTGTGCTTACGTGACTGAGATCGTCCTTGCTGCCTGCTACAAGGCCCTCAACGACCAGCATGTCCTCCTTG
AGGGCACCCTCCTGAAGCCCAACATGGTCACCCCTGGGTTCCGACTCCAAGAAGGTGGCCCCTGAGGTGATTGCTGAGTACACTGTCCGCACCCTCCAGA
GGACCGTCCCTGCTGCCGTCCCCGCCATTGTCTTCCTCTCTGGTGGACAGAGTGAGGAGGAGGCGACCCTGAACCTGAACGCCATGAACAAGCTCCAGAC
CAAGAAGCCATGGAACCTGTCCTTCTCCTTTGGGCGTGCCCTCCAGCAGAGCACCCTCAAGGCCTGGTCCGGCAAGACGGAGAACGAGGAGAAGGCCAGG
GCGGCGTTCCTGGTGAGGTGCAAGGCCAATTCCGAGGCCACCCTCGGCACCTACAAGGGTGACGCCACCCTCGCTGAGGGCGCCTCTGAGAGCCTCCACG
TCAAGGACTACAAGTACTGATCTATCTGCCTTCGGAGCTGTGGCCCGTTTGGGCGTCCCGCTTACCAGTATCATTGTCATTGTTTGGTTTTCTGAGTCCT
GATATATCCTCGGATATCGAACATCGTTTTTAATAATATGGAACTTGTGTTTTCATAATACCGTAGTAGTTTCTTTTTGGAGTTGAAGTACCCTGGAAAT
CGGGTGCTGCGTATCGTATATTGGAGCAGGTTTTTGTTCCATGGTCCTGTAATTTACCTGCTCATACAATGTTAAAACCTGTCATATGCTGAGTACACAT
GTGTTCCGGCAAAAAAAAAAAAAANCAAAAAAAAAA
page-top