Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2698
Contig Information
Length 633 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 12 Clones [Download: CSV  ,  FASTA ]
whms10o15    whms3i03    whms3i04    whms3i15    whms5c22    whms15i24    rwhms10o15    rwhms3i03    rwhms3i04    rwhms3i15    rwhms5c22    rwhms15i24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal Pr 117 [Triticum aestivum]
Score 693
Evalue 2.68181e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2698
CTTCGCGTCGCCGCTCGGAGCAAGCGCCGCAGGGGACGCCGCCATGTCGAAGCGCGGGAGGGGAGGATCGGCGGGGAACAAGTTCAGGATGTCGCTGGGT
CTGCCGGTGGCAGCGACGGTGAACTGCGCCGACAACACGGGCGCCAAGAACCTGTACATCATCTCCGTGAAGGGCATCAAGGGAAGGCTCAACCGCCTGC
CGTCGGCCTGCGTCGGCGACATGGTCATGGCCACCGTCAAGAAGGGGAAGCCCGACCTCAGGAAGAAGGTCATGCCGGCGGTCATCGTGCGCCAGCGCAA
GCCATGGCGCCGAAAGGACGGTGTCTTCATGTACTTCGAAGATAATGCTGGGGTGATTGTGAATCCTAAGGGTGAGATGAAAGGATCTGCTATCACAGGA
CCCATTGGTAAGGAGTGTGCTGACCTCTGGCCTAGGATCGCTAGCGCAGCAAATGCCATTGTCTGAGGAGCTTGATTGGGATAATGATATGTTTCCTTAG
TTTCAGATTTGTCCTGGATGATGAATGTACCTGAATTATTTGTTTGCCAGATATTTATCCGAATGAGGCTCAACCTCTTAACTCTTTTGTTCTCTGGGTT
AAAAGATCTCTTTATCACTTATCAAAAAAAAAA
page-top