Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2691
Contig Information
Length 2134 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 11 Clones [Download: CSV  ,  FASTA ]
whms1a04    whms1l03    whms4e21    whms13a22    whms17c04    whms8b04    whms8g20    rwhms1a04    rwhms8g20    rwhms13a22    rwhms17c04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit heat shock protein 90 [Triticum aestivum] >gi|110270510|gb|ABG57076.1| heat shock protein 90 [Triticum aestivum]
Score 2915
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2691
GTTCGAGAGCCTCACGGACAAGAGCAAGCTCGATGCGCAGCCCGAGCTCTTCATCCACATCATCCCCGACAAGGCGACCAACACGCTCACGATCGTCGAC
AGCGGCATTGGCATGACCAAGTCGGACCTCGTCAACAACCTCGGGACCATCGCCAGGTCGGGGACCAAGGAGTTCATGGAGGCCCTCGCCGCCGGCGCCG
ACGTGTCCATGATTGGGCAGTTTGGTGTCGGTTTCTACTCCGCCTACCTCGTCGCCGAGAGGGTTGTCGTCACCACCAAGCACAACGACGACGAGCAGTA
CGTGTGGGAGTCTCAGGCCGGTGGCTCCTTCACCGTCACTCGTGATACGTCTGGGGAGCAGCTCGGCAGGGGTACCAAGATGGTGCTCTACCTCAAGGAC
GACCAGATGGAATACCTTGAGGAGCGCCGCATCAAGGATCTAGTTAAGAAGCACTCTGAGTTTATCAGCTACCCCATCTCCCTGTGGACCGAGAAGACCA
CTGAGAAGGAAATTTCTGACGATGAAGATGAGGAGGAGAAGAAGGATACTGAGGAGGGCAAGGTTGAGGATGTTGATGAGGAGAAGGAAGAGAAGGAAAA
GAAGAAAAAGAAGATCAAGGAAGTCTCTCATGAGTGGAACTTGGTCAACAAGCAGAAGCCTATCTGGATGAGGAAGCCAGAGGAGATCAACAAGGAAGAG
TATGCTGCTTTCTACAAGAGCTTGACCAATGACTGGGAGGAGCATTTGGCTGTCAAGCACTTCTCTGTTGAGGGCCAGCTTGAGTTCAAGGCTGTCCTGT
TTGTGCCCAAGAGGGCCCCCTTTGACCTCTTCGACAACAAGAAGAAGGCCAACAACATCAAGCTGTACGTGCGCCGTGTCTTCATCATGGACAACTGTGA
GGAGTTGATCCCTGAGTACCTGAGCTTTGTCAAGGGCATTGTTGATTCAGAGGACCTTCCCCTGAACATCTCCCGTGAGACTCTCCAGCAGAACAAGATC
CTCAAGGTCATCAGGAAGAACCTTGTCAAGAAGTGCATTGAGCTCTTCTTTGAGATTGCTGAGAACAAGGAGGACTACAACAAGTTCTACGAGGCCTTCT
CCAAGAACCTCAAGCTTGGCATCCACGAGGACTCCCAGAACAGGACCAAGATTGCTGAGCTTCTGAGGTACCACTCCACCAAGAGTGGTGATGAGCTGAC
GAGCCTCAAGGACTATGTGACCAGGATGAAGGAGGGACAGAACGAGATCTACTACATCACTGGTGAGAGCAAGAAGGCTGTGGAGAACTCTCCCTTCCTT
GAGAAGCTGAAGAAGAAGGGCTATGAGGTCATCTACATGGTTGACGCCATTGATGAGTATGCCATTGGTCAGCTCAAGGAGTTTGAGGGCAAGAAGCTTG
TCTCTGCCACCAAGGAGGGTCTGAAGCTCGATGAGAGCGAGGACGAGAAGAAGAAGCAGGAGGAGCTCAAGGAGAAGTTCGAGGGGCTGTGCAAGGTCAT
CAAGGAGGTGCTGGGCGACAAGGTGGAGAAGGTCATCGTCTCTGACCGTGTTGTGGACTCCCCTTGCTGTCTGGTGACTGGCGAGTATGGGTGGACCGCC
AACATGGAGAGGATCATGAAGGCCCAGGCCTTGAGGGACTCGAGCATGGCTGGCTACATGTCAAGCAAGAAGACCATGGAGATCAACCCTGAGAACGCCA
TCATGGACGAGCTCCGCAAGCGCGCCGACGCCGACAAGAACGACAAGTCAGTCAAGGACCTGGTGATGCTGCTCTTCGAGACCTCCCTGCTCACCTCCGG
CTTCAGCCTGGAGGACCCCAACACCTTCGGCACCAGGATCCACCGCATGCTCAAGCTTGGCCTGAGCATTGACGAGGACGATGAGGCGCCTGAGAACGAC
ACCGACATGCCGCCCCTGGAGGACGACGCTGGTGAGAGCAAGATGGAGGAGGTCGACTAAGCGCCAAGTCTGCCTGTCGTCGGATGTTCATGCCCTGCAC
CGCCTAGTTGTTTTTATCTTTAGTGTCGACGTTGGATGGTCGCTGTATCGGTTTTGTCTTTTGGCTGGCCAAACATTAAGCGCGGCTAGCTGTTTGTGGT
ACTCGTGGAACAGTTCGTTATTGTTGGTTCTATA
page-top