Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2676
Contig Information
Length 825 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 10 Clones [Download: CSV  ,  FASTA ]
whms3o06    whms5g02    whms6o09    whms14k23    whms20h06    rwhms3o06    rwhms5g02    rwhms6o09    rwhms14k23    rwhms20h06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_12360 [Oryza sativa Indica Group]
Score 675
Evalue 5.60059e-69
Total Hit Count 399
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2676
CACAACCAGACGGCAGGTAAGGGAGGAGGAGAGCGGCGGCGAAGATGGTGTCGCTGAAGCTGCAGAAGCGCCTGGCCTCGAGCGTCCTCAAGTGCGGCAA
GGGCAAGGTCTGGCTCGACCCCAATGAGGTCAACGAGATCTCCATGGCCAACTCCCGGCAGAACATCCGGAAGCTGGTAAAGGATGGTTTCATCATCAGG
AAGCCTCAGAAGATCCACTCCAGGTCTCGTGCAAGGAGGGCACATGAGGCCAAGCAGAAGGGCCGTCACTCTGGATATGGTAAGCGTAGGGGTACCAGGG
AGGCTAGGCTCCCCACCAAGATCCTGTGGATGCGGAGGATGCGCGTCCTGAGGCGCCTTCTGCGCAAGTACCGTGAGGCCAAGAAGATCGACAAGCACAT
GTACCATGACATGTACCTGAAGGTCAAGGGTAACATGTTCAAGAACAAGAGGGTCCTCATGGAGAGTATCCACAAGTCCAAGGCTGAGAAGGCAAGAGAG
AAGACCCTCTCTGATCAGTTTGAGGCCAAGCGCGCCAAGAGCAAGGCAAGCAGGGAGAGGAAGCATGCCAGGAGGGAGGAGAGATTGGCTCAGGGCCCCA
GAGATCATGCACCAGCACCAGCGGCTGCAGCTCCAGCTCCAGCAGCAGCGGCACCAAAGAAGGCCAAGGCCAAGAAGTGAAGGTCTGACATGAAGCTTTA
GCTTTCTGGTATCATGAAGGGTTAGCCTGATTTTGGAGCATCTGAAGTTCAGAACTGTTTTCTGTGCAATATCTGTGTGCCGCGTATGAGATACCTTAAA
TATCATATCGTGTTTGTTCTGTGGA
page-top