Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2671
Contig Information
Length 782 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 10 Clones [Download: CSV  ,  FASTA ]
whms10b10    whms13p19    whms14i15    whms15n24    whms19n23    rwhms10b10    rwhms13p19    rwhms14i15    rwhms15n24    rwhms19n23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0565000 [Oryza sativa (japonica cultivar-group)] >gi|33146750|dbj|BAC79661.1| putative 40S ribosomal protein S11 [Oryza sativa Japonica Group] >gi|50508298|dbj|BAD30107.1| putative 40S ribosomal protein S11 [Oryza sativa Japonica Group] >gi|113611543|dbj|BAF21921.1| Os07g0565000 [Oryza sativa (japonica cultivar-group)] >gi|215768067|dbj|BAH00296.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195559|gb|EEC77986.1| hypothetical protein OsI_17372 [Oryza sativa Indica Group]
Score 731
Evalue 1.63948e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2671
CTCTCAGAGCCTTGCTCCCGCTTCCCCTCGACGCGCCGCCGCCGCCGCCTCCGAGCCCCTCGACGCCCACCTCGCAGCCATGGCGGAGCAGACCGAGAAG
TCTTTCCTCAAGCAGCCAAAGGTTTTCCTCAGCACGAAAAAGGCCGACAAGGCCAAGAGGCCAGGCAAGGCTGGCAACCGCTTCTGGAAGAGTGTTGGCC
TTGGTTTCAAGACCCCAAGGGAAGCGATCGATGGTACCTACATTGACAAGAAGTGCCCATTCACTGGAACTGTTGCCATCAGGGGCAGAATCATAGCTGG
AACCTGCCACAGTGCCAAGATGAACAGGACCATCATTGTTCGCAGGAACTACCTTCATTTTGTGAAGAAGTATCAGAGGTATGAGAAGAGGCACTCCAAC
ATCCCAGCTCACATCTCCCCCTGCTTCCGAGTCAAGGAAGGCGACCATGTCATCATTGGCCAGTGCAGGCCCCTGTCGAAAACCGTGAGATTCAATGTCC
TGAAGGTTGTTCCAGCTGGAACCACCGGAGGCGGGAAGAAGGCTTTCATCGCTGCTTAAGCCCAGGCTCTGATTCATGAGTAGTTCATAGTCAGACGTTT
TAAGCACTTAAACCTACCAGGCTGCTGCTGTTTTGCGATTTGATTCCTGTGTTTTCTGTCAAACCGAAGAATGTCGTGATCTGAACATGTCTTGTGGAAT
CTATCTATCATTAATAGTTTTGCTTAAAATTGTACGGTCAGTTTTTTCTTTGGTGCTGAATTGGTTTTGCCCAAAAAAAAAA
page-top