Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2658
Contig Information
Length 1298 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 9 Clones [Download: CSV  ,  FASTA ]
whms10e23    whms10o06    whms6g20    whms11c19    whms16k20    rwhms10o06    rwhms6g20    rwhms11c19    rwhms16k20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 1636
Evalue 4.19412e-180
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2658
CCTCCTCCTAAACCACTCTCCCTATCCCCGTGTCCAGAATCTACCCCCCGGCTCCAATGGCGGCGAAGGAACCGATGCGCGTGCTCGTCACCGGCGCCGC
AGGACAAATCGGATATGCTCTTGTTCCCATGATTGCCAGGGGAGTTATGCTTGGTGCAGACCAGCCTGTTATTCTGCATATGCTGGATATTGAATTTGCT
GCTGAAGCTCTTAAAGGCGTCAAGATGGAGTTGATCGATGCCGCATTTCCACTTCTCAAGGGAGTTGTTGCAACAACTGATGTTGTTGAGGCTTGCACTG
GTGTGAATGTTGCGGTTATGGTTGGTGGATTCCCCAGGAAGGAAGGAATGGAAAGGAAGGATGTTATGACGAAAAATGTTTCAATCTACAAAGCTCAAGC
ATCTGCTCTTGAAGCTCATGCAGCCCCCAATTGCAAGGTTTTGGTTGTTGCCAACCCAGCAAACACCAATGCTCTCATCCTGAAGGAGTTTGCTCCATCT
ATCCCTGAGAAGAACATCAGTTGTTTGACCCGCCTAGACCACAACAGGGCACTCGGTCAGATTTCTGAGAGACTTGGTGTCCAAGTTTCTGACGTTAAGA
ATGCTATTATCTGGGGTAATCACTCGTCCAGTCAGTATCCTGATGTTAACCATGCCACTGTGAAGACTCCCAGTGGAGAGAAGCCTGTTCGTGAACTTGT
TCAAGATGATGAATGGCTAAATGGGGAGTTCATTGCCACTGTCCAGCAGCGTGGTGCTGCAATCATCAAAGCGAGGAAGCTCTCCAGTGCTCTCTCTGCT
GCCAGCTCAGCTTGTGATCACATCCGTGACTGGGTTCTGGGAACCGCTGAGGGAACATTTGTTTCCATGGGTGTGTACTCTGATGGTTCATACGGTGTGC
CTGCTGGTCTTATCTACTCCTTCCCAGTAACGTGCAGTGGTGGTGAATGGACAATTGTTCAAGGGCTCCCGATCGATGAGTTCTCGAGGAAGAAGATGGA
TGCGACCGCCCAGGAGCTGTCAGAGGAGAAGGCGTTGGCCTACTCATGCCTGGCGTAAATCCACATTCGAAGGGCAGCTGCTCCTCTGGATGTTTTGAAT
AAATGAAACCTTCCGCTCTTTAGAAACTCTCGTCTCCACCCAGAACAGCCGCACATCGCGATGCATGCTCCTTTTCGCTGGTTTTCCAAGTGTGTATGAA
TGAGGCTTGTAGCTCCCCTTTTGCCTGATGATTTACAGGACAGTACATTTGCTGCAAGAGTGAAACAATTTGACACCTGATTAGAATCAAAAAAAAAA
page-top