Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2656
Contig Information
Length 2029 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 9 Clones [Download: CSV  ,  FASTA ]
whms1a19    whms1o06    whms12g08    whms13j04    whms16o19    rwhms1a19    rwhms1o06    rwhms12g08    rwhms13j04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_28114 [Oryza sativa Indica Group]
Score 670
Evalue 7.71668e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2656
CTCGCTCCCTACACTCCCTCCTTGCCTCTACGCCGCCAGCGGTCCATGGGCAAGTCAAGCAAGAAGTCCGCGGCCCCTACTGTCGTGGCGCCGGCGGCCG
TCCTTACCAAGGGGAAGGCCGGGAAGAAGCGCGAAGCCGATGACGAGATCAAGAAGGCTGTAAGCGCAAAGAAACAGAAGGCTGCGCCGGCAAAGGCGGT
GCCCGGGCCCAAAGAGGCCGCCAAGAAGGCCAAGAAGCAGCCGCCGCCCAAGAAGGTTGAGAGCAGCAGCTCTGAGGAGCAGTCATCCGAGTCCGAGGAG
GAGGAGGTTCCTAAGAAGACTGCAAAGCCTGTCAAACACGAGTCTTCAGATGATAGCAGCGACGATTCCTCCTCTGACGAGGAACCTGCAAAGAAGCCTT
CTGCTAAACCTGTGACCCCAGCTGCCAGCAACGGCTCAAAGAAAGGCAAGCCTGAGAGCAGCTCTTCTAGTTCTGAGGATGAGTCCGATGATGACGAGAA
ACCTGCTGCTCTGGTAAAGAAAACACCAGTCATCGAATCTGACAGCTCCGAAAGTGACTCAGATGATAGCTCAGATGAGGATGTTCCTGCCAAGACTCCT
GCTGCTGCTGCCAAGAAGGTAGATTCTTCAGACAGTTCTGAGTCGGAGAGTGAATCTGAGGATGAGGAGAAGTCAAAGAAAGCCGCACAGGCCACCAAGA
TAGCTCCTGCAGCTGCTAAAAGAAAGGAGGAGCCCAGTGATTCCTCAGACAGTGATGAGAGTGATGAAGAGCCTCCCCAGAAAAAGCTGAAGGATGCTGC
GAAGGTTACTCCTAAGTCTGCCAAAAAGGACAGCACCAGTGATGATGACAGTTCTGATGAAAGCTCTGATGATGAGCCTAAAAAGAAAGTTACAACTGCC
TCAAAATCACAGAAGGAAGAGCCTAAAACTCCTGCTAGCAACAAAGGTCAGGCAACAGGGTCGAAGACCCTTTGGATGGGGAACCTTTCCTTCAATATTG
AGTATGATCAAGTGAAGCAATTTTTTGCACAAATTGGAGAGGTCGTTGATGTTCGCCTGGCTACCCATGAAGATGGCCATCCCAAGGGATTTGGTCATGT
TGAGTTTGCTACGGCTGAAGATGCTCAGAAAGCGCTTGATTCACTGAATGGTGGAGATCTAATGGGCCGTCCGGTGAGACTTGACATGGCTGCTGAAAGA
GGTGCAACTCCTCGCACCAGGGATGGTGGATCGTTTGGAAAACCAAGTGGAGGTCCCAGCCTCTCAGTATTTGTCAAGGGTTTTGATTCATCTCAACAGG
AGGATGCTATTCGGAGCTCTCTTCAAGAACACTTCTCTAAATGTGGAGAAATCACACGTGTCTCAGTTCCGATGGATTATGAGAATGGTGCAAGCAAAGG
GATAGCTTACATGGATTTTACTGATGAGAGTTCCTTTTCGAAAGCACTTGAGCTTAGTGGATCTGACCTAGGTGGCTGCAACTTGTATGTTGCTGAAGCT
AAGCCTAAGGGTCAATTTGGTGGCGTTGGTGGTCGATCTGGTGGCAGAGATGGTGGCCGCTCTGGTGGTGGCAGGTTTGGCCGGTCTGGTGGCCGTGATG
GCGGCGGCAGGTTTGGCCGGTCTGGTGGCCGTGATGGTGGCGGCAGGTTTGGCCGGTCTGGTGGCCGTGATGGCGGCAGAGGAGGCGGCCGAGGCTTTCA
GAGCAGACAGAGTGCTGGCACAGCTAGCGCAGGGAAGAAGACCACATTTGGTGACGATTAGAAACTTTTTGAGCCACAAAATGGTCTGATGCAACTGCCG
CGTGTCTAGACGACTGTATCCCCGTGTTTCCCATTATCCTAGTGGACCTAGTATCATTTGTCTGTAGTATTTTCTTGCCGCTATATGTTGTAATGCCAGA
ATTCTACTATATATGTTACACCTAGTGTTTTTTTGCTACTTCCTCTATCCAAGTATTCAAGACTAGAAGTGGTCATGCATCTCCTATAAAATAGCCAATC
ATTAGTACCAAACAAACCAGGTCCCTGAT
page-top