Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2625
Contig Information
Length 632 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 8 Clones [Download: CSV  ,  FASTA ]
whms4e13    whms5o05    whms16j07    whms8k23    rwhms4e13    rwhms5o05    rwhms8k23    rwhms16j07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein P1 [Triticum aestivum]
Score 305
Evalue 2.62784e-26
Total Hit Count 341
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2625
CCAAACCCTAGAAGCTCCCTGCCTCCTGCGCCTCCACTTCCATCGCCTCCCAAGATCGCAGATCTGCTCCGGTGAGAATCCGTCGCCATGTCTTCCAGCG
AGGTCGCCTGCACCCTTGCCGCCCTCATCCTCCACGATGACGGGATCCCCATCACTTCTGAGAAGATCGCGACGGTGGTGAAGGCTGCCGGAATCAAGGT
TGAGGCCTACTGGCCCGCGCTCTTCGCCAAGCTCCTGGAGAAGAGGAGCGTCGATGACCTCATCCTTTCCGTCGGATCTGGTGGAGGTGGTGCTCCAGCT
GCTGCTGCTGCTGCCCCGGCTGCTGGTGGTGCTGCTGCCGCTGAAGAGAAGAAAGAAGAGAAAAAGGAGGAGGCTAAGGAAGAGAGCGATGATGACATGG
GCTTCAGCTTGTTCGACTAAGCAGTTCAATTCCAGTTCTCCTGTGGAATCTTTTATGCTAAGGATTACTTATCTTATGTGCTTTTAGGTCGAATTTTGCG
GATTTAATATGTTTGAGACCTAAGTATCTGTGCAATGAGTACTGCAAACCACCTTGGGATGGTCTTTTTAGAATGAAAATGGTTTTGGTGCTTGGTTGAA
AAGCCATTGCTTGTTTTACCCTAAAAAAAAAA
page-top