Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2604
Contig Information
Length 1377 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 8 Clones [Download: CSV  ,  FASTA ]
whms1l02    whms2n22    whms5f23    whms18c20    rwhms1l02    rwhms1l13    rwhms2n22    rwhms18c20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Chain 4, Structure Of Signal Recognition Particle Receptor (Sr) In Complex With Signal Recognition Particle (Srp) And Ribosome Nascent Chain Complex >gi|119390381|pdb|2J37|4 Chain 4, Model Of Mammalian Srp Bound To 80s Rncs
Score 517
Evalue 2.57892e-50
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2604
CACCCCAGGAAGGTAAGTTCAAGAGGCTTTTCTGAGAAGCTCAAATGGCTCCCAAAGTTGCTGTTGCCAAGAAGGGCGATGCCAAGGCCCAGGCCGCCAA
GGTTGCCAAGGCTGTGAAGTCTGGGTCAATCAAGAAGACGGCAAAGAAGATCCGCACTTCTGTGACATTTCACCGCCCCAAGACCCTGTCCAAGGCCAGG
GACCCCAAGTACCCCAGGATCAGCACCCCTGGAAGGAACAAATTAGACCAGTACCAGATCCTCAAGTACCCGCTTACCACTGAGTCTGCGATGAAGAAGA
TTGAAGACAACAACACCCTTGTCTTCATTGTCGACCTCAAGGCCGACAAGAAGAAAATAAAGGCTGCTGTCAAGAAAATGTATGACATTCAGGCCAAGAA
GGTTAACACCCTCATCAGGCCTGATGGCAAGAAGAAGGCGTACGTGAAGCTGACACCAGACTACGATGCTCTTGACGTGGCCAACAAGATCGGCATCATA
TAAGCCAGAGGGAGGGTCCTGCAGTAGGCGCTTGTGTCGTGGTTTCTTATGTTATTGGAATTTTGTAGTTGTTACTTAGCAAAGGGCCTTAGTGGCTCCA
TTGCCTACCATATCGCCGCACACTTTCATGAATTTGATGCAATCGAAGTGACTTGTTGATGCTAATTCATGCCTCGTGCCGAATTCGGCACGAGGACCTT
CCCAGCCAAAACATCACCGCACATCTCCCCGGCGAAGCAGCAGTAACCAGCGGCATCCATGGCCCCCAAGGCGGAGAAGAAGCCGGTGGCGGAGAAGGCC
GAGAAGACGACGGCGGCGAAGAAGACCAAGGCCGAGAAGCGGCCGCCGGCGTCCAAGGAGGGCGGCGAGAAGAAGGGGAAGAAGAAGGCCAAGAAGAGCG
TGGAGACGTACAAGATCTACATCTTCAAGGTGCTGAAGCAGGTGCACCCGGACATCGGCATCTCCTCCAAGGCCATGTCCATCATGAACTCCTTCATCAA
CGACATCTTCGAGAAGCTGGCCGGCGAGTCGGCCAAGCTCGCCCGCTACAACAAGAAGCCCACCATCACGTCCAGGGAAATCCAGACCTCTGTCCGCCTC
GTCCTCCCCGGCGAGCTCGCCAAGCACGCCGTCTCCGAGGGAACCAAGGCCGTCACTAAGTTCACCTCCGCTTAGATAGTCTGCTCCTGTCTTCTTGGTC
GATCGATGGTAACTGTTTCATTATCTTGTGAAATAGTGATGGTGCTTCTTTGATCTGTCTCGTGGCTCTGTACCATTTTCAGTTCTAGTCCCTGTTGCTT
CATTTGACAGAGTTCTTGCTATGACCCTGTTTGTGTGAGTTTATCTTGGAGAGATGTTTCTGATTGCAAAAAAAAAA
page-top