Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2602
Contig Information
Length 726 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 8 Clones [Download: CSV  ,  FASTA ]
whms10d20    whms2o07    whms9o09    whms14e10    rwhms10d20    rwhms2o07    rwhms9o09    rwhms14e10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Protein H2A.7; AltName: Full=wcH2A-4; AltName: Full=wcH2A-10 >gi|536892|dbj|BAA07278.1| protein H2A [Triticum aestivum] >gi|536896|dbj|BAA07280.1| protein H2A [Triticum aestivum]
Score 444
Evalue 2.69452e-42
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2602
CCCACACCACACCGCTTCCGCACTTCCTCCCGGCGCCTCGTTTTCCATTTCACAACCGCGGATCCCCTCCAAGCACTGTAGACATGGCCGGAAGGGGCAA
GGCGATCGGCTCGGGCGCTGCCAAGAAGGCCATCTCCAGGAGCTCCAAGGCTGGGCTCCAGTTCCCCGTCGGCAGGATCGCGCGGTTCCTCAAGGCCGGC
AAGTACGCCGAGAGGGTCGGTGCCGGCGCCCCCGTCTACCTCGCCGCCGTGCTCGAGTATCTCGCCGCTGAGGTTCTGGAGTTGGCCGGGAACGCGGCGA
GGGACAACAAGAAGACCCGCATCGTGCCGCGCCACATCCAGCTCGCCGTCCGCAACGACGAGGAGCTCTCCCGCCTGCTCGGCATGGTCACAATCGCCAG
CGGTGGTGTCATGCCCAACATCCACAACCTTCTGCTCCCCAAGAAGGCCGGAGGCAGCAAGGCCGTGGCTGCCGACGACGATAGCTAGATGACGACTCCT
CGGTGGTCGTGGGTGCTCGGCTGTATCCAGTTCTGTGTAGTAGCGTGTTCAGTTAAATGTTGCCTAGGTGTTGCGTTTTACTTCTAGGATGTTAGTACTA
CTATTAGTTTCTGAATCTGTGTGCTTGTACCGGTGCTAAACTAGGTGTGGACAATGGTTACATCCTGTGTAAGTCGTTGCTANTTCGTTCTATAAAAGTT
GCACCTATGGATTGCTCAAAAAAAAA
page-top