Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2598
Contig Information
Length 721 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 8 Clones [Download: CSV  ,  FASTA ]
whms10c18    whms2p06    whms9m22    whms17b03    rwhms10c18    rwhms2p06    rwhms9m22    rwhms17b03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216896 [Zea mays] >gi|194696926|gb|ACF82547.1| unknown [Zea mays]
Score 620
Evalue 1.03311e-62
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2598
AACCCTAGCCTCCTCCTCCTCTCGCCGCCGCCGCCGCCGCCGCCGCCATGTCAGGGAGGAAGAAGACCCGCGAGCCCAAGGAGGAGAACGTGACGCTCGG
CCCCGCCGTCCGCGAGGGGGAGCACGTCTTCGGCGTCGCGCACATCTTCGCCTCCTTCAACGACACCTTCATCCATGTCACGGATCTGTCCGGGAGGGAG
ACGCTCGTCCGCATCACCGGTGGCATGAAGGTGAAAGCTGATCGTGATGAATCATCCCCTTATGCAGCTATGCTTGCATCTCAGGATGTTGCTGTAAGAT
GCAAGGAGCTTGGAATTACTGCTCTGCACATTAAGCTCCGTGCTACTGGTGGAAACAAGACAAAAACTCCAGGTCCTGGTGCTCAAGCTGCGCTTAGAGC
TCTTGCACGTTCTGGCATGAAGATTGGACGCATTGAGGATGTTACCCCGGTTCCAACTGACAGCACTCGCCGGAAGGGTGGTAGAAGAGGAAGGAGGCTG
TAATTCCATGCTCGTTCAAGGATGGAACAATACCAAGCTATCGATATCCTGTGTCTTGCAACTTGTTCTGTACTACTCCGTTTATGATGTTACTCCGTTT
ATGATGTTAAGTCAGATCTTGTGGATTTATAGATTTTGAGCGATATTGTGTTGCATGTTTAGAAAATGACCCTTTTCCCTGCTTTGAATCAAGTGGTTGC
CATCTATTATTAAAAAAAAAA
page-top