Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2580
Contig Information
Length 795 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 7 Clones [Download: CSV  ,  FASTA ]
whms10f15    whms13d18    whms17e23    rwhms10f15    rwhms13d18    rwhms17e23    rwhms20l16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0241200 [Oryza sativa (japonica cultivar-group)] >gi|108707099|gb|ABF94894.1| NHP2-like protein 1, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547985|dbj|BAF11428.1| Os03g0241200 [Oryza sativa (japonica cultivar-group)] >gi|125543066|gb|EAY89205.1| hypothetical protein OsI_10701 [Oryza sativa Indica Group] >gi|125585560|gb|EAZ26224.1| hypothetical protein OsJ_009707 [Oryza sativa (japonica cultivar-group)]
Score 540
Evalue 2.37566e-53
Total Hit Count 410
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2580
GACTGAGCAGAACAAGCACAAAGATAACCCACGACATGAGCAATCGCACACAAGCAGCTAGTAGTTCCCAATTCTCAAACTCATAAACCATTACCCGTTA
CAACATTTGTTGAGTCTAGGGAGAAATTCAACTGCCATGACACATGTGTCTTATGGATTACACAAGTCACAAATATAAGATGACGACATAATGGCAGCAT
GATTTAACATAACAGTCTTGCAAAATATAGCTGAAAAAACACAAAGACCTAGTAGACAAGACACCATCACCAGTCCAAGCCTCTGAAAAACTGTGTCGCA
GAGGCCCATCACACTGAAAGGTCTTGATAAATCATATGAGAAGCTTCTCGATAGCATCCTTAAGACTCTGAATGGGCTGTTTCAGCTGGCTACCCTCGTT
GCTGGTCACTGAACAAGCAATGACCGGCCTAGTCACTCCACAAGCACGCCCAAGGGCTTGCTTTGAAGGGACAAAGACATATGGCACATTCTTGTCCTCC
GCGAGCAACGGGAGGTGGAGGAGGATTTCGAGCGGCTCCGTGTCAGCTGCCATCACCACGAACTCCGATATTCCCCTGTTGAGAGTCTTGGTCGCTTCGT
TGGCGCCCTTCTTGAGCTGCTTGTAGTTGGCGGCCTGCTGGACGAGGTCGAGGATCGTTATCGTCAGCTGCGAGTCCGCCAGCGGGTAGGCCTTGGGGTT
GACCGTCTCCTGACTCATTTTCCCGACGGGTTGGTCGGCTTGGAGGCGCGGGGAGGAGGGGGAGGAGGCGGCCGCCGCGGGTGGGGGAGCTGGCG
page-top