Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2570
Contig Information
Length 1245 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 7 Clones [Download: CSV  ,  FASTA ]
whms10c08    whms7b21    whms7l08    rwhms10c08    rwhms7b21    rwhms7l08    rwhms16g03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Unknown (protein for IMAGE:5194336) [Homo sapiens] >gi|111494016|gb|AAI11385.1| Unknown (protein for IMAGE:5198300) [Homo sapiens]
Score 1312
Evalue 1.46268e-142
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2570
CACTTTGCGGCTGGCCGGCGTTCACCATACAAGCAAACGGGCTCTCCGAACAGACAGCATGATCACGATGGTCGATGGACCATAAGAAAATGAGAGCATA
AGTTGCCATCACGAAGAGCGACCTCTGACTAAGTAACGCCCAAGTATTCATCGTTCTCATTTCTCATGGAGCAACACACAGGCTACATCCAGGACATGAA
GCAAGCGGGCAGATCAAACCATTTCCCCAAAGATCCTTGTAATTTACACCATGATGTTACAATTTGAACCACCCATTATGTGTGCAGTTCACCGCAGTTG
CCTTGATATATGGCTACAACTCGCAGCTAGCGAGCGCCAACGCCTCACTTGCCGGGGACAAAGTTTGTGGCAAACGCCCATGCGTTGTTGTTGACAGAGT
CGGAGAGGTGGTCAGCGAGGTTCTCGAGTGGGCCCTTGCCGGTGACGATGGCCTGCACGAAGAAGCCAAACATAGAGAACATGGCGAGGCGACCGTTCTT
GACTTCCTTCACCTTGAGCTCCGCGAATGCCTCTGGATCGTCAGCCAAGCCCAGTGGGTCGAAGCTGCCCCCGGGGTAGAGTGGGTCGACTACCTCACCG
AGTGGGCCGCCAGCAATGCGGTACCCCTCAACAGCGCCCATGAGCACGACTTGGCATGCCCAGATAGCAAGGATGCTTTGTGCGTGCACGAGGCTGGGGT
TGCCCAGGTAGTCGAGGCCACCCTCGCTGAAGATCTGGGAACCGGCCTTGAACCATACCGCCTCGCCGAACTTGACGCCGTTGCGTGCAAGAAGCTCGGG
GAAGACGCATCCAAGCGCACCGAGCATGGCCCACCGGCAGTGGATCACCTCGAGCTCCCGGTTCTTGGCAAAGGTCTCGGGGTCGGCCGAGAGCCCGGCG
GTGTCCCATCCGTAGTCGCCGGGGAACTCGCCGGTCAAGTAGCTCGGGGGCTCTCCGGAAAGCGGGCCGAGGTAGAGCACACGGTCGGCACCGTACCATG
GGCTGCCTGATGAAACCGGCTTGGCCTTTGCAGCGGTCTTGCGCATAGTGACACGGGCCTCACCAAAGAGAGCTGATGAAGCCACGTTCTTCACCGACTT
GCCGGCGAAGGTCGAGGAGAGGGACATGGTGGTGGTCGCCATTGCGCTGCTAAGGTGGGAGGTGTATTGTGTGTTCTCCAAACAATGAAAACTGAAGAGT
GTGGAGATGGTTTGAGACGTGTGGAGGATGGAGCTATTTAAGGAA
page-top