Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2568
Contig Information
Length 1410 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 7 Clones [Download: CSV  ,  FASTA ]
whms10c09    whms2j09    whms5f10    rwhms10c09    rwhms2j09    rwhms5e12    rwhms5f10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1410
Evalue 7.53172e-154
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2568
GTACATCAAACACCCGATCCTCAAACGACAAAAATAATCTTGGGTACATCTTGGATTACTCTAGTGGAATCAACAGAAACAAAGTGGACGATACACAAGT
CGCCATATACAGTAACATGCAGTTCTAACCTCAGCCAGTCGGCCTGCAGGCTAGCTACCACAGGTAGTAGATTCTTACACAACGAATAAAATGCCGATTC
AAGTATGACTATATAAAACCAATGCCAAGGAATGTAAAACATGATGACGTCCATGTCTCTTCATGGGGGCCAAGTGAAGTGATTTACAGGAACACGTCCT
TCTCGAGCAGCTTGAGGACCTCGTCCTGGTTGTTCAGCTTGGCGACGTCGATGGGCGTCTTCCCATCCATGTTTTGGAGAGTGACAGCAGCACCGTGCTT
CAACAGAAGATCCACACACTCTTTCCGGCCATAGCCAGCAGCGTAATGCAGTGGGGTGTTCTTGTTCTTATCCATGGCATCTACAGCAGCACCCGCCTCA
AGGAGGATTTCCGCACACTTGAACTCACCATATCCACATGCAAAGTGCAAGGCCCTTCTTCCCTCAGAGTCTTCTTCATCCTTGTCTGCTCCACCATCTA
GAGCCTTCTTCAGACCCTCACCGTCACCAACACTGGCAGTGTGGTGGACAATGGATTCGTCTTCATCTTCACCTTCTTCTTCAGTTTCTTCAGTACCAGA
AGGTTCAGCAGTAGAGACAGTGCTAAACGGCATGGTAGTTCCCATTGCCTGGCCAATCTTTTGAAGAGTTTCAGGGTCATTCCAGTACTTTATCATTGCA
GCAGGACCACCATTCTCTAACTCATCAAGAATTGGCTTCAAGGCTGGATCTTCCTTAATCCGAGACATGCGCTCTTCAAGCTCCTCCTTATGTGTTGGAC
TAGTCAAATTTTCCAGCATACTGGACATAGCAGGATCCTGCATAAGAGCAGTCCCGAGGCGCTCTGCCATTGTCATAAACTGAGGGTTTTCCATGACCTT
TTGCATTGTTTCCATGTATTGATGAGGATCCAATGGAGGCATGCCCTGTTCTCCTGCAGTCTGAGCACCTTTCTGTAGCTGCTCAGCCATCTGATTGAAT
GCAGGGTCCCTTGCAATCTGGTCCGCCATCTCCTTTATAGATGGATCATTGAGCAAACTTTGCATAGAAGAAAAATCGAAAGGACCCGACAAGCCTGCAG
CGGCAGCTGGAGGAACCCCTTGACCTTCGTTGGATGATCCTTCTGTTTTCGTACTTTTGCTCTCATCAGCGAACCCGGATGGGAGATCTCCACCCGACGC
CATCCCGGTAGATACGAGGAGTAGGGGAAGAAGAATTCGTCCGAGGTGGGCTGCTTGCGTCGGCCGGAGGCGGAGCTCGGCGGCGCGGTGGGGGAGGAGA
GAGTGCTGCC
page-top