Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2540
Contig Information
Length 697 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whms10g02    whms10g14    whms10p03    rwhms10g02    rwhms10g14    rwhms10p03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glycine decarboxylase subunit [Triticum aestivum]
Score 783
Evalue 1.20169e-81
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2540
TAAATTAGGNTACAATGGCTCTGAGGCTGTGGGCAAGCTCAGCTGCCAATGCCCTCAAGATTTCAAGCAGCGGCGCCAGGGCCGCTGCCCCGGCCTACTC
GATCTCCAGATACTTCTCCACCGTTATTGATGGCTTGAAGTACACTTCCTCCCACGAGTGGGTCAAGAACGACGGCTCCGTGGCCACGATTGGCATCAGT
GACCACGCCCAGGGCCATCTCGGGGAGGTGGTGTTCGTGGAGCTGCCGGAGACCGGCACGAAGGTGAGCCAGGGTGGGGCCTTCGGCAACGTGGAGAGTG
TGAAGGCCACCAGCGACGTCAACTCGCCCATCTCCGGCGAGGTCGTCGAGGTCAATTCGAAGCTGTCCGAGACCCCGGGCCTGATCAACTCGAGCCCGTA
CGAGGAGGGGTGGATGATCAAGGTGAAGCCGAGCAGCCCGGCGGAGCTGGAGGGCCTGCTGGACTCGGCCAAGTACACCAAGCACTGCGAGGAGGAGGAC
GCCCACTAGTGCTCCCTTGTTCGCTTATCAATCCTTTTGCTGCAACCATATCGAATACTCTTGTCTACAATAATTAAACCAGCTTCACCATGCGTTCAGT
TCATCGGTTCCAATTTTCTTGTGTCGGTGTACATGGCGGCCAGCACTTTGTTATACCATTTCAGTGACCGTGACATCAGAGATATGGAAAGAGTTGT
page-top