Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2486
Contig Information
Length 1065 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whms10c06    whms3f15    whms4n22    rwhms10c06    rwhms4b19    rwhms4n22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mitochondrial ATP synthase precursor [Triticum aestivum]
Score 1049
Evalue 3.66e-112
Total Hit Count 157
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2486
GCGGCCGAGAGATCGAATCGGAGAAGAAGAAGGAGCGGAGAGGCCTCTGCTGCCCTAGCTCCGCCGCCCCCGCACCAGCCATGGCGCTCGCCGCTCGCCT
CGTATCCCGCTCCCGACAGTTATATTCTGTCCAAGCTGCTTTGGCCAATGGAGGCGTCACTCAAGTCCGCTCATTTGCCAAGGAGGCAGCTCCTGTCAGC
GGAGATGACCTATTGAAGGGCATCTTTTTTGAGGTGAAGAAAAAGTTTGAGACCGCACTTGGGGTCCTTAAGAAGGAGAAGATCACGATAGACCCAGATG
ACCCAACAGCAGTTGCTAACTATGCCCAAGTCATGAGGACTGTAAGAGAAAAGGCAGATCTTCTTTCCGATCCTCAGAGAATTAAACATACTATTGAGAC
TTTCACGAAGGGCATCCCTGATGCAAGGACGTACTTGGATACCCTTCAGCAGCTCAGGAAAAAGAGTGGTCTCATAGATGATATGGGTATTGAGGATATG
ATGATGGAAGCTCTTGAGAAAGTTGAGAAGGATATTAAGAAGCCTCTTCTGAGGAGTGACAAGAAGAACATGGGTCTCCTCTTGGCAGAGTTTGACAAGA
TAAACAAAAAGCTTGGCATTCGGAAGGAGGATCTTCCCAAGATTGAGGAAAATCTTGAAATGGAACTTGCCAAAGCTGAGCTGACGGAACTTAAGAAGGA
AGTTGTTGAAGCAATGGAGGGTCAACTAAAGAGGGAGGAGTTTAAAGATGAGGCGATGCCTGACGTCAGGAAGTTGGACATTAGAAACTTCCTCTAGGTC
CCTGATTGATGATAACCCTTGGGGTGACCGATCTGTGATTTTTCTTTTCAAGTGACGGCAGGTGCTGTAAGCCACACCGAATGGATGTTATTGTTGCTTT
TTGTAATAAAACTGCACCGAGAATACGACGACAGTCAACCGATGAGTTGCGTTGCTTGGTTACCTTCCGGCGTTGAGAGTTTTGTTTCTTAGGCTGGCAA
CGTGAACATCAAGCGTTGCTGAATATGTGCCTGCGGCTGCCTGTTGTATGTAGTAGCCACACATA
page-top