Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2485
Contig Information
Length 749 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whms10e05    whms7m07    whms20p18    rwhms7m07    rwhms13p16    rwhms20p18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit retrotransposon protein, putative, Ty1-copia subclass [Oryza sativa (japonica cultivar-group)]
Score 663
Evalue 1.15009e-67
Total Hit Count 351
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2485
TTTTATGACAAGAACTCACAAGCATAAGATTCTCCCAGGCGGGCAGATAATTTAAAAGCTCAGACAATAACCATTGTACCAGAATAGCATGCGATCTACT
TCAACGAAGTCTTGGATAACAAACACAGGGGGGTATCATAATTCAAAACTGTAGCCAAATTCTACTACCGAACACGATTGCATAGAGGGGACTTCAACTG
ATCAGAATTCGGCAGGAACAGTTCCTGCAACCTGGTCCAGATCACGCCTTCCCTGGGAGGTGATGAGCCTTCCACCCTTGGGGTCCACATCAATGATGCC
CATCTTCTGCAACTCCTGGAGGATGTTGCGGGACACAGCACCACTGCTCTTGCAGAAGTGCGGTGGGCGTGAACCATTCCTCTGACGGCCACCGTAGATC
TTCTGGAAGCCGCCGATCCCAATTCCCTGCCTCAGGTAGATCTTCCTTGCCATCGAGGCAGCCCTGATGTAGTACCAGTCAGCATCAGAAGGTGGAAGCT
CCTTGAACCTTGCAGTCTTGACAATGTCAACCCACTCCGGAAGCTCCATCTTGCCGGAGCGCTTGAGGTGCGCGGAGTAGGCCTTGACGAACTCGTGGGG
GTTGACATCCTTCACCGTGCGCGCCGTGGAGGCCGCGGTCTCGGCTGCGGGAGCGGGCACGGTCGCCATCCTGTGCTCTCGCCGACGGCGGCGCTGTCTT
CAGGGAGGAGGGAGAGGTGTGCGCGCCGCTGCGGCTGCGAGGGCTAGGG
page-top