Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2467
Contig Information
Length 1124 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whms5c20    whms14j03    whms17f14    rwhms5c20    rwhms14j03    rwhms17f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 14-3-3 protein [Hordeum vulgare]
Score 1305
Evalue 8.25477e-142
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2467
TTCGAAAGCCCAAGCGCGACGAGGAGACCAGCGGCGACACACGCAGACGCAGATTTGGCATTCAGAAAAAATTGAAATTGTGAACTGTGAAGATGACGGC
ACCAGCGGAGCTTTCCCGTGAGGAGAATGTGTACATGGCTAAGCTCGCCGAGCAGGCTGAGAGGTACGAGGAGATGGTTGAGTTCATGGAGAAGGTGGCC
AAGACCGTCGACTCCGAGGAACTCACTGTGGAGGAGCGCAACCTGCTCTCTGTTGCATACAAGAATGTGATTGGAGCCCGCCGTGCCTCATGGCGCATCA
TCTCCTCCATTGAGCAGAAGGAGGAGAGCCGTGGCAACGAGGACCGGGTCACGCTCATCAAGGAGTACCGTGGCAAGATCGAGACTGAGCTTAGCAAGAT
CTGTGATGGCATCCTCAAGCTGCTCGAAACCCACCTTGTCCCGTCTTCCACTGCCCCTGAGTCCAAGGTCTTCTATCTTAAGATGAAGGGTGACTACTAC
AGATATCTTGCCGAATTCAAGAGTGGGCCTGAGAGGAAGGATGCTGCTGAGAATACCATGGTGGCATACAAGGCTGCTCAGGATATTGCTTTGGCTGAGC
TGGCTCCAACTCATCCGATTAGGCTTGGGCTGGCACTGAACTTCTCGGTGTTCTATTATGAGATCCTCAACTCGCCTGATCGTGCTTGCAATCTCGCAAA
GCAGGCATTCGATGAGGCCATTTCGGAGCTGGACACCCTGAGCGAAGAATCCTACAAGGACAGCACCTTGATCATGCAACTCCTTCGTGATAACTTGACC
CTCTGGACTTCTGACATCACGGAGGACACCGCGGAGGAGGAGATCAGGGAGGCTCCAAAGAACGACTCGAGCGAGGGGCAGTAAAGCCGGCTTTGCGACG
CCCCGCAAGCTCCTAGCTAGTGTTTGCTACTGTCAATGACATTGCAATGTGGTCTGGATATGTCGTAGCCGTGTTATGGTTGTTGTCGCAAGATTTGAGG
CTCCCCCGTATGTGATGTTGCCGGGGAAGGTTGCTGTCGCCGCTTGTAGCGTAGCAGGCGGTGGCTGCCTCCTGGTCTGGCTCGGGAGGGAGCCCCATAG
ACTGGTGGTGGTGGTGGCCGTTCG
page-top