Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2458
Contig Information
Length 810 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whms5a21    whms5a22    rwhms10e12    rwhms5a21    rwhms5a22    rwhms15f16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38995 [Oryza sativa Indica Group]
Score 601
Evalue 2.07265e-60
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2458
TTTTTTTTTTCAGGTAAAAGAACTTCATGAACTATTATTTGTTGGTGCATCTAACAACTCATTTTCCTTCACAGCTAATACATAGTAGTACAATACGTTT
TATTGCTCTTATTCCTGTTGAAGCTCCGCAGCTGCCCTCGAGCACAGTTCGAAAGTAGCTAGCTTGTCAACGGCTGCAATACGAGCAAGCCTGGTAGTGG
ATTAGTAGCCGGCGAAAAGACAGGATGATCACAGGTATGTAGGACATAGGCACTTGCTTATATGTCAGCTCCATCGCAGGTCCTACTCTTAGCGAGTAGC
CTTACTTTTGGCCTCGCTTAACATCTTCTTGATCTCACTGCTGTCAGGGTCGAGTCTCAGCGCCTCCTGGAACGCATCAACTGCCCTTTGGTGATCCTCC
ATGAAAATGAGAGCTGAGCCCTCTCGGTACCATGCCTTGGACCAACCAGGACGCAGCATTTTGCACCGTTGAGCGTCTGCCAGTGCTCTGTCCCCTTCTC
GCATGCGCAGCCAGCAGAGGCTCCGGTTAGCAAACAGGGTCGCATCAAGTGGGTCTATCTCCATCACCAGTCCATAGTAGTACATTGCTGTAAAGTAGTC
CTTCTTTGCAAATGCTTCCTTCCCTTGTGACTTCAAATCAGCTTTCCGTTCTTCTGCAGAAGCTCTATCCTGAACCCTGGTCTGTGGAGATTTCATAGTT
GTAATTATCCCATCAACACTCCAATCAGGCACAGATGGAATTGGGTTTGTCTTAGGAAACAGAAGCTCAACAAGTTCACGTTGACCACGGACTGCTGCTC
TCTTGATTGG
page-top