Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2456
Contig Information
Length 1049 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whms1b02    whms4i04    whms5l17    rwhms1b02    rwhms4i04    rwhms5l17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1094
Evalue 2.16449e-117
Total Hit Count 496
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2456
GGAATAAACTAAATATTTAGTTTTAAACTCATAACCTCCATCCAGAAAGTAACACGAACAAAATAAGATAACTGAACGCTGGCTAGGAATGTCGACAGAA
GTACTCAAGAAATCAGCCATCAAAACTGACTACAAAGTTCACGACACCCAGGTGGCACATATATCATCTTCTAGATATGAAGCAGCAAAATAGCGACTTC
TATTTTCTACTCAGCAGCAGCAACCTCCTCCGCTCCAGGAATCACCTCATCTCCATCAGCAGGCCTGTCAAGCTTCACACCAACATCCTCCTTGTAGTCA
CCGTGCACCTCCATGAGCTTCCCCAGGTCAAACTTGGGGGCCTTCAGGATCTTCACCTTGCGGACGTACACGTTCTGGAGGGGGAAGATGCTTGAGGTGG
CCTTCTCAATCTCCTTTCCAATCACCTCAGGGATGAACTTGTTCACAAGCTCCTTCAAGTCACAGCTTGCAGCTTGGTTGACCATGATCTCAACCATCTT
GCGGCGGATCTGTCTGATCTGACTTGCTTGGGCATAGCAAGTGCGCTTCACCTGGTTTGGGCGTCTCTTCGTGAAGCCAATGGTGAACATGCGGAGCATG
TAGTTGTCAGTGGTCTTCACATCCACATGAGCCTCAATGAGTGTCTGCCACTTCCTCACAAGAGACCTGAGCTTGTCAGTGGTGAAGTCCATGCCCCAGA
AGTTTGTGAGGACATTCATCCCTTGCACATCCTCAGCACGGAGTCTGATCTTCCTGTAGGCCTGGTCCTCATCGTTCTGAAGATCAGCTAGAGATACTTC
GAACACCCTGTGCTTCAGACCCTCTGAGGCAATCTTGGTACCCTGTGTCCTGGACACGAGGGTCTTGCCGACGTTGCGGCTGGTGAACAGCAGCGGCGCC
TTGATGTCATACCACTGCTTCTTGGTGAACGGATCGACGGCCTTCTTTTTGCTACCCTTCCTCCCCTTGGAGATGCGCTTGTTCTTGCCGACCGCCATGG
TTGCCGCTGCGGGTGGAGTGGCGGCGCTGCGGCGTCTGGGGGCTGAGCG
page-top