Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2441
Contig Information
Length 1088 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 6 Clones [Download: CSV  ,  FASTA ]
whms15a14    whms20m01    whms18d09    rwhms15a14    rwhms18d09    rwhms20m01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Precursor of CP29, core chlorophyll a/b binding (CAB) protein of photosystem II (PSII) [Hordeum vulgare subsp. vulgare] >gi|445122|prf||1908428A chlorophyll a/b-binding protein
Score 1338
Evalue 1.16861e-145
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2441
GCCCCTTCTCTCTCACTTTGGGCTCGAGGCAATGGCGGCGCTCGCTCCGACGAAGATGCTCGGCACCCGGCTCAACTTCGCCGGCTCCTCCAGGTACGCC
ACAGCGGCACCAACTGCTGGCGCACAGAAGATCGTCTCCCTCTTTGATCGCTTCAAGAAGAAGCCTGCCCCGAAGCCGAAGCCCGCCCCCGTGGCCACCT
CGAGCGTAGGCATCGACGACGAGCTCGCCAAGTGGTACGGCCCTGACAGGAGGATCTACTTGCCCAACGGTCTCCTTGACCGGTCGGAGGTGCCGGAGTA
CCTCAACGGAGAGGTTCCCGGAGACTACGGCTATGATCCTTTTGGTCTGGGCAAGAAGCCAGAGGACTTCGCCAAGTACCAGGCCTTTGAGCTCATCCAT
GCCAGGTGGGCCATGCTCGGCGCCGCCGGATTCATCATCCCCGAGGCGCTCAACAAGTTCGGCGCAAACTGCGGCCCCGAGGCCGTTTGGTTCAAGACCG
GCGCCCTTCTCCTCGACGGCAACACCCTCAACTACTTCGGCAACAGCATCCCCATCAACCTGATCCTCGCCGTCGTCGCCGAGGTCGTCCTCGTCGGAGG
CGCCGAGTACTACAGGATCACCAACGGACTGGAATTTGATGACAAGCTCCACCCAGGTGGCCCATTCGACCCGCTCGGCCTCGCCACCGACCCGGACCAG
GCGGCGCTGCTCAAGGTGAAGGAGATCAAGAACGGGCGGCTGGCCATGTTCTCCATGCTGGGGTTCTTCATCCAGGCCTACGTCACCGGCGAGGGCCCCT
TCGAGAACCTGTGCGCGCACCTCAGCGACCCCTTCGGCAACAACCTGCTCACCGTCATCTCCGGCGCCGCCGAGAGGGTGCCCAGCCTGTGAGCTGGCCG
TTAATTGCCCGTCCGCCGCCGTCGGCTGTTGATGATCAGCTGCGTGCGATGCGCGCGATGCAGCATCATGTGCTGTGTGAATTTTACCGGGGAAAAGTAT
GAGAGTACGAATGTGCCGTACGTGTAAATTATCAAGGGGCAGAAGAAACATGACCGTTCTGATTTCTGATGGGAGTATCGGACCACTG
page-top