Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2328
Contig Information
Length 1131 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 5 Clones [Download: CSV  ,  FASTA ]
whms7e17    whms7k22    whms13o11    rwhms7k22    rwhms13o11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit seed maturation protein [Zea mays]
Score 1023
Evalue 4.13242e-109
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2328
AGGGGGAAAAGAAAGAAAAGGAAAACCAACCAGAAGAAAAGCTCGGGAGGAGAGCGTGGGGGGACTAGGGAGCATGGCGGAGCACAAGGAGGAGCCGGTG
GCGGAGTCCATGATGGACAAGATCTCCGACAAGTTCCACGGTGGGGACTCGTCGTCGTCGTCCTCGGACTCGGACGACGAGAAGAAGGGGTCGGCGGCGG
GCGTCAAGGCCAAGATCTACCGCCTCTTCGGCCGCGAGAAGCCCGTCCACGCCGTCCTCGGCGGCGGCAAGCCTGCTGATCTTGTTCTATGGAGGAACAA
GAAGGTCTCCGGAGGGGTGCTTGCTGGCGCTACTGCCATCTGGCTGCTGTTCGAGGTCATGGAGTACCATCTGCTCACCTTGGTGGGCCACTGCCTCATC
CTCTCCCTGGCAACCCTCTTCCTCTATTCCAATGTCTGCATTTTCATCCACAAGTCTCCCCCGAACATCCCTGAGGTGAAAATCCCGGAGGACATGACTG
TAAACATTGCACTATCACTGCGGCATGAGATCAACCGGGGCTTCTTTACCTTGAGAGAGACTGGTCATGGTCGTGATCTGAAGAAATTCCTCATTGTGAT
TGGAGGGCTCTGGCTTCTTTCTGTTCTTGGGAGCTACTGCAACTTTTTGACACTGTCATATATAGTCTTTGTGGTGCTGTACACTGTGCCAGTTCTGTAT
GAGAAGTACGATGACAAGGTGGATGCTTTTGGTGAGAAGGCCATGATCGAATTGAAGAAGTATTATGCCATCTTTGAAGAGAAGGTCCTGTCGAAGATCC
CGAAGAACAAGAAGCACTAGATCACAAGAGTTACCCTGCCGCGTATTGCCATCTGTGTTAATCTCAACTTGTTGCCTCATTTTGAAGGATGGTTCTGTGT
CATTGCGTCTGTCTTTAGTTAATACTACTTGATACTAGTACATATAGATGTGGTGTGCTAATCCTTTTGTGAAGTGGAGTCATGCCAGCTGAAGATTGTT
GATCTTCTTTTTTTTGTTTATTTTTCAACTTTCAGCATGGTTACTCTATCTGGGAGCCGGAAATGTTATGGCATTACCTGTTCTAGTGCCTAGTGATATA
CTACTGCGTAGTGATTTATCCAAAAAAAAAA
page-top