Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2293
Contig Information
Length 529 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whms10a22    whms1c13    rwhms10a22    rwhms1c13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H4 [Zea mays]
Score 410
Evalue 1.07616e-38
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2293
TCCTCGACCCCCATCCTCTCGCGGCTCGAACCAAGAAGAGATCTTCAGCCATGTCGGGGCGCGGCAAGGGAGGCAAGGGGCTCGGCAAGGGCGGCGCCAA
GCGCCACAGGAAGGTGCTGCGCGACAACATCCAGGGCATCACCAAGCCCGCCATCCGGCGCCTGGCGAGGAGGGGCGGCGTGAAGCGCATCTCCGGCCTC
ATCTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACTGTCACCG
CCATGGACGTCGTCTACGCCCTCAAGCGCCAGGGTCGCACCCTCTACGGCTTCGGCGGCTAGGCTCTTCCTTGCCCCCTTGCAGATCCCAAAAGTTTGAT
GATACCGCGACTTGTGTAGTTCTCTACTTCCTCTGTAGTTCGCTATTTCCTCTGTATTTCGAACTGAATCGTGGAGCAAACCTATTCGCAGTTTGTTAGA
ATTCAAACTTGTCTAAGTGAAAAAAAAAA
page-top