Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2287
Contig Information
Length 1483 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whms10d10    whms6o19    rwhms10d10    rwhms6o19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit TaWIN1 [Triticum aestivum]
Score 1344
Evalue 3.63514e-146
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2287
AACGCGTATTGCCTCCTACGCCCCCGGAATCCGCTGCTCCACCCCCCAACTCCGTTGCCACACGCCCTTGCACAAGCGAGCGAGCAACCATGTCGCCAGC
AGAGCCGACGCGAGACGAGAGCGTCTACATGGCCAAGCTTGCGGAGCAGGCCGAGCGCTACGAGGAGATGGTGGAGTTCATGGAGCGCGTCGCGAAGGCC
ACCGGCGGGGCAGGGCCCGGGGAGGAGCTATCCGTCGAGGAGCGCAACCTGCTCTCTGTGGCTTACAAGAATGTCATCGGGGCCCGGCGCGCGTCCTGGA
GGATCATCTCCTCCATCGAGCAGAAGGAGGAAGGTCGGGGCAACGACGCGCACGCCGCCACCATCCGCTCCTACCGCAGCAAGATCGAGGCCGAGCTCGC
AAAGATCTGCGACGGCATCCTCGCCCTGCTTGATTCCCACCTCGTGCCATCCGCCGGAGCTGCCGAGTCCAAAGTCTTCTATCTCAAGATGAAGGGCGAC
TACCACAGGTACCTTGCAGAGTTTAAGTCCGGTGGGGAGAGGAAGGAAGCCGCCGAGAGCACCATGAACGCGTACAAAGCTGCTCAGGATATCGCCCTAG
CAGATTTGGCTCCAACCCACCCCATCAGGCTTGGGCTTGCACTCAACTTTTCTGTGTTCTACTATGAGATCTTGAACTCCCCTGACCGCGCCTGCAACCT
TGCAAAACAAGCCTTTGATGAGGCTATATCAGAGCTGGACAGTTTAGGCGAGGAATCCTACAAGGACAGCACTTTAATCATGCAGCTCCTGCGTGACAAT
TTGACTCTATGGACATCCGACACCAATGAGGATGACGTTGATGAGATTAAGGAAGCCCCAGCTCCAAAAGAATCTGGAGACGGACAGTGAGGTGAATGAA
AATAACAGTCTGTGCATTGTTGGGGGCAATGGAAGTCGGTCTTGGTTCTAGTGCTCATACTGTTGTCATCACTACCTCTGTTTAATTATGCACTTGAGAA
GTTTCTGGGCTATGTTTTTCTGGTGCTCATAAATGCTGGCTGGATTCGTGTTTTCTTGTTCAAATCTGGCCACAAGCAAAAGACCTGCTCTTTTTCACCA
TTAGAATGTTTGCTATATCTACCATGTTTGGTGAGACTTGATGCGACTAGACTAATTTGCTGAAATTGCGGTATCCTGTTCATGTTTGGCTGAACTACAT
TCTGACAAGATGGTTTGCGCAAAGATGTTCATTTGCACGTGCTAGCTGTGGCATGGCCTCAATCGATTGAGAAGAATGTCAAGGTTCACCTGATTGATGC
TTTTCTTGGCCCAGTTTTCGTTGCAACTAGAAGCAAAGGTGCGCTTTGCTGCGTTGTTCCTATCATTCTTGGCATTGTCATGGTGATTGATATGGCAAAT
AATCCGATGCGCTGCAAGAATTTCTATCTAGTCACCTTCCTGAAGAATGTAACGTGAGCTAAATGAGGAATGTTATACAAAGT
page-top