Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2281
Contig Information
Length 818 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whms6m21    whms12m20    whms13a23    whms18p01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Beta-amylase; AltName: Full=1,4-alpha-D-glucan maltohydrolase >gi|1771782|emb|CAA67128.1| beta-amylase [Triticum aestivum]
Score 1429
Evalue 2.04519e-156
Total Hit Count 329
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2281
GGGCCCAGGCGTACGACTGGAGCGCCTACAAGCAGGTCTTCGACCTGGTGCACGAGGCCGGGCTCAAGCTGCAGGCCATCATGTCATTCCACCAGTGCGG
TGGCAACGTCGGCGACGTCGTCAACATCCCCATCCCACAGTGGGTTCGCGACGTCGGCGCCACCGACCCCGACATTTTCTACACCAACCGCGGCGGGACG
AGGAACATCGAGTACCTCACCCTTGGAGTGGACGACCAGCCTCTCTTCCATGGAAGAACTGCCGTCCAGATGTATGCTGATTACATGGCGAGCTTCAGGG
AAAACATGAAGAAGTTCTTGGATGCCGGTACCATCGTGGACATTGAAGTGGGACTTGGCCCAGCTGGAGAGATGAGGTACCCATCGTATCCTCAGAGCCA
AGGATGGGTCTTCCCAGGCATCGGAGAATTCATCTGTTATGATAAGTACCTGGAAGCAGACTTCAAAGCAGCAGCGGCGAAGGCTGGCCACCCTGAGTGG
GAATTGCCTGACGATGCTGGAGAGTACAACGACACTCCCGAGAAAACCCAATTCTTCAAGGACAACGGAACATACCTCACAGAGAAGGGGAAGTTTTTCC
TGTCATGGTACTCCAACAAACTGATCAAGCACGGTGACAAGATCTTGGACGAAGCAAACAAGGTCTTCTTGGGATGCAGGGTGCAGCTGGCAATCAAAAT
CTCTGGCATTCACTGGTGGTACAGGGTTCCAAACCATGCAGCCGAGCTCACAGCTGGGTACTACAACTTANATGACAGAGACGGCTACANAACCATAGCA
CGCATGCTCACAAGGCAT
page-top