Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2216
Contig Information
Length 620 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whms10d01    whms18b07    rwhms10d01    rwhms18b07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_06622 [Oryza sativa Indica Group]
Score 338
Evalue 3.72422e-30
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2216
GAGGAATCAACCTCTATTTCATTTTTTCTTCTTGTGATCTTCGGTAGCAACAAGAAGTCAAGAGCAACACCATCGATGGCACGGGGAACCATGGTACCCA
CCCTTTTGGTGCTGCTTCTGGCTGTTTGCTGTGCAACCACTGTCGTCCATGGCAAGGAGTGGACCGTTGGCGACAACAAGGGATGGAGCTTTGGCGTCTC
CGGATGGGAGAGTGGCAAGCACATCCAGTCCGGCGACGTGCTTGTGTTCAAGTACAACCCGAGTATGCACAACGTGGTGCAGGTGGGAGAAGAAGACTAC
AACTCGTGCATTGTCTCGAGCCCGTCGAGGACCTACACCTCCAGCAATGACCACATCCAGCTCGCCCGCGGAGGCAAAGTGTTCTTCATCTGCAACCTTC
CGGGTCACTGCCAGCAAGGCATGAAGATCGCCGTCACTGCTTAATAGATCTCGCGCATATGTGTGTCTTTGTGTTTGTATTTTTTACCAAGTCTTTAAGG
TGTGCTAGCTCATGATGATTTGGTGATAGATAGAAGAAATAAAATGATCCTAGTGTATTGTCTGCATCATGTTTTCATGGAACCTTGATAAACCAACATC
TATTTGGACTAAAAAAAAAA
page-top