Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2148
Contig Information
Length 573 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whms10b17    whms14k01    rwhms10b17    rwhms14k01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L36 [Triticum aestivum]
Score 540
Evalue 1.16055e-53
Total Hit Count 290
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2148
GCGGCGGCTTAGGGTTTTAACTCGCATCCATTCTCAAGGTTAGCAGGAGACCGGCCATGGCGCCGTTGCAGCCCAAGTCAGGGCTCTTCGTCGGCATCAA
CAAGGGCCACGTCGTCACCAAGCGCGAGCTGCCGCCTCGCCCGTCCGACCGCAAGGGGAAAGGTACCAAGAGGGTGCTGTTTGTCAGGAACTTGATTAGG
GAGGTCGCTGGATTTGCTCCCTATGAGAAGCGTATCACTGAGCTTCTTAAGGTTGGAAAGGACAAGCGCGCACTCAAGGTCGCCAAGAGGAAGCTTGGTA
CTCACAAGAGAGCAAAGAAGAAGAGGGAGGAGATGTCAAGTGTCCTCAGGAAGATGAGGTCTGGTGGTGGTGGTGCTACGGACAAGAAGAAATAGATTTT
GCATGTTGATTTATCTCAATGCTTTGCCCTGTATTTCCACATTATGCCAAGTTTGTAGCCTGTGGCAATTGGAGACGAATGTAGTACATTGCACTTCAAG
TTCAGAGTCAAACTATGAATTTTTGACACTATTTGCAATTGGAGTGACATGGTAGTACATTGCAAAAAAAAAA
page-top