Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2146
Contig Information
Length 823 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
rwhms10a02    rwhms10m18    rwhms15e06    rwhms17m14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_025439 [Oryza sativa (japonica cultivar-group)]
Score 861
Evalue 1.51461e-90
Total Hit Count 369
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2146
GTCGTAGACGGTCCCTGGACAGATAACGTAGTCCAGGGTTAAAAATGTGCACTCTGCATAAATATCCATGGTAACAACTAATACACAACACAAAGTAGGT
AACGATCCTTCCAAATCCTGGTACAATAATGTCGAAAATGATAGCAGATGACAGCAATGCTCACATCTGAATATAAAATGTTTGTTCAGTAATAAGCAGC
AAAAGGATGACCACCGTCTCCGCAAACATGGGGTATAAGGAAATACTCATTTTAAAGCAACAACCGTGCCTCTTTATTCTTCCTCCTCTGCCTCCTCAAG
CCATTTGACGAAAGGCTCCAGAGCTTTCACGAAAGATTGCCTTCCTTTTTGGTTTGAACCCTTGCGGAACCAAAGAAGTATGGTATCTTCAGCTAGGACA
TCTTGATCATACAGTGATCTTATAATTTCAGGGAACAGCTTCATCAACTTAGCATCCTCATAACATTGTGTCTGGACCTTGTATATGAGTTCCAGTTCTA
GCTTTCCACTTGTGCAAAATGCATTCATAAGACCAGCCCAAGCATTCACCTGCCTAAGTGCTGAATTAGAATTTTGCTGCTGGTTCTTTCCAGACCACTG
AACAGCCTCCATCAGCACATCCCACAGCATGCGAACAACCTCTATATCAGGAAATTTAGCATCTTTAACCTGTTGCTTGACAACCTCAGTTACTTCAGAT
ATTTCAGCTTCTTCATTGATCATAGTGGTCAGAGTTGACTTTATCTCCTTGAGCTTAACTTCAAACATTTTCTTGCTATTGTACTCAACAAGGCTAGTCA
AACCTTCTTTGGTGAAATGCTCA
page-top