Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig2018
Contig Information
Length 767 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whms10g01    whms14j11    rwhms10g01    rwhms7d13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative immunophilin [Hordeum vulgare subsp. vulgare]
Score 668
Evalue 3.18176e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig2018
ATCCTCCTCCTCTCTACCCGAACAAACCCCAGCTGCATCCATGGCGAAGCCGCGGCTTCTTCTCTGCCTGCTGGTCGCCGCCGCCGCGCTCCTGCTCGTC
GCCTCCGCGAAGAAGTCCGGCGACGTCTCGGCGCTCCAGATCGGCGTCAAGTACAAGCCAGAATCCTGCAGCATCTCGGCTCACAAAGGTGACAGAGTTA
AAGTTCACTACCGTGGAACACTTACCGATGGAACAGTTTTCGATTCTAGCTTTGAAAGGGGTGACCCGATTGAATTTGAATTGGGCACTGGTCAAGTGAT
CAAAGGATGGGATCAGGGAATTTTGGGCATGTGCATTGGTGAGAAGAGGAAGCTGAAGATCCCTTCAAAGCTCGGCTATGGGGATCAGGGATCACCACCT
ACCATTCCAGGCGGAGCAACTCTCATATTCGACACAGAGCTTGTCGCTGTCAATGGCGAGCCATCTAGCAAATCAGAGGAGGATGACGCTGATCTGTAGG
CAGCTCGGCGCAGCACGATCGCCCAGTTATCAAATCGAATAGGACTATGTATGGGAAACTTACTCTTGTAGGGCAGACACAATGAGGCAGGAACATTGTC
TTACCATGATCAAACAGAGGAGCCTAGTTCTCAAAATCGAATAGATCAAGTGACTTTTGTTACCCTATGTAATTCTCTGGAATAATTCTCCTATCTACCT
TGTTACTTTTGCTTTTGTTCTTGGAATGGTTATAAAGTACTACTCCCTTCATTTCTCAAAAAAAAAA
page-top