Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1991
Contig Information
Length 934 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whms10c01    whms10c02    rwhms10c01    rwhms10c02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_18877 [Oryza sativa Indica Group]
Score 168
Evalue 4.31457e-10
Total Hit Count 52
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1991
GCAGCGCAGCAACCAACCTCGAAATCCAAGATCTACGTCGACAGCAGAGGAACCATCAATCAAGAAGAGGCCATGGCCGGCAAGGAGGAGGCGGGGAAGT
TGATGGTGAGTCCGGGCAGCGCTGCCAATTCGACGGAGGCCAGCGTCGATGGTCCTGCGGCGGTGTTCCCCTCCGCCGCCGGATCCATCTACAAGGAGGG
TGACGAGTCTTTCGAGTCAGACAAGGGGGTGACTGCGATGGACAAGATGCTTGGGGAGGCGAATCTGTCATCCGCCGTCGCCAATCAGCCGGCCGCAGCA
CCACCAGGTCCAAACAAGGGCAAGGTTCGGCTGTCGAAAGCCGAGATTAGGACCATAATTGCGCTGAAGCCGGAGCAACACCCCAGCGCCGATTACCTGG
ACGATCTGGCAGAGTATTTTCCTCTGGAGTGGATTGAGGAAAGGAAGCGTGCCCACGCTGACAGTGTAGAGCTTTTCAAGAAGATGGACGACGATTTCGA
AGAGTACCGGCAGGAGGTCATCGCGTCTGTGCGGGACAAGGGCTACTACGAGGTCGATGAAGAACTCATCGCCAACAGGGAAAGGGGGAACGAAAACGCT
GCCGAACAATGGAAGAAGATTGATTGGACTGGAATACAGATTGCTATCCCGGAGGACAGGCTGAGGGATTCTGATAGCTATCGTCCATACGTTCCTGACC
AAGATGATGCTCTTGTTGAAGCTCTTGTGATCGAGTGATTCTCAAAGATAGTCTACTTGACGAAGACTAGACGGCACAAAGGATCAATCTTGTGGCACAA
CTGCGAATAGCGCTCACTTGACCCATCTGTATCTATCGTCTTACATTAAGGTTGTATCAGTCTTTCTATTACTAGTAGCATTGGTACTAGCTTATGACCT
GCGTTATGATAGTGCTTTCTATCCATCCGTGTGT
page-top