Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig27
Contig Information
Length 542 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl19l18    whfl1l20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit oxidoreductase [Zea mays]
Score 501
Evalue 4.1409e-55
Total Hit Count 43
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig27
agGGACTCGGCAAAACCCTAATTTTCACCCAGTTCGGCCCTTCCAAACCCTAACCCTAATACGCTCGATGTTGTAATCCCGCCGCGTTTGCCATGGCTCT
AGAGGGGCCCGCGGAGCGACGGGACGAGGGCCAGCAGGGAGGGATGGCGAACGGGAATGGCGTGGCTCCGCCGCCGTCGCGCATGGCCGGCCGGCCGTTG
GGGGCGGCTGCGTACTCTGACAGGCGGCTGCGCCTCAATCCGAACACGGAGCACAAGCCGCAGGACTACACCGACGTGCGCGGCGAGTACGCGCCAGCCG
TGTACAGCGCCCTGGAGCGGCACCTCCCGCCTAGCCTCCTCGAGGCCGACCGTGATGTCAAGCTACACTTCATGCGGGACATACTCGCGCGCTATTGGCC
CCATGGCGAGCGAAACAAGGTTCATAGGCACAAAGAATACAGGCAGAAGATAGTCCaccctcTATAAGCCACTTCATCAAGAATTGTACAGCATGCattc
ctTCGGCTTTCTTcttaccaacattccttgaagcagtaagaa
page-top