Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1942
Contig Information
Length 786 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
whms10a02    whms10m18    whms15e06    whms17m14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)]
Score 1069
Evalue 1.05863e-114
Total Hit Count 138
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1942
CCCCGAAAGCTAGGTTTTTATCACTCCACCTATCATCATCGCCTCGGCGGCCGCACAACCCACCCTCCCCCTCGAAGCCCCGATCTCCTTCACTTCTCCT
CTCCGTGCCAGATCGTTGTTTATGAGCTCGAAGGAGAAGCCCACCCTCGGAGGCCAGCGGATTAAGACCCGCAAGCGGAATATCGCAGCTCCTTTGGACC
CTTCGTCGTTCTCTGATGCAATTGTCCAGATTTATCTGGATAATGCTGGAGACCTGGAACTTGTTGCCAAAAGTATAGAGTCATCAGATCTCAACTTCTC
ACGTTACGGTGACACTTTCTTTGAGGTTGTTTTCATTGGTGTGCGTACTCAGCCTGGTACGATTAAACCCGAAGAAGAGGGAGAGCGCCACCCCTATTCT
CTCATTGACTGTGCAGCACAACGTGAAGCAATATTACCTTATGTCCTCTTTATTCAGAAAACACTGCGCAGGAGGCCTTTCTTAATAAAGAGTCTTGAAA
ATGTTATGCGAAAATTTCTCCAGTCTTTGGAGTTCTTTGAAGAAAATGAGAGACAAAAACTTGCCATTTTCACGGCACTTGCATTTTCTCAGAAATTATC
AGGTCTGCCACCTGAAACTGTCTTTCAGCCATTGCTTAAGGACAATCTTGTTGCCAAAGGGATAGTGCTTTCATTCATTACTGAGTTCTTCAAGGAATAT
CTGAAGGAAAATAGTTTGGATGATCTGATTGCACTTTTAAAGAAAGGCAAAATGGAGGACAATTTACTTGAATTTTTTCCATCAGG
page-top