Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1935
Contig Information
Length 709 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 4 Clones [Download: CSV  ,  FASTA ]
rwhms10b16    rwhms8e13    rwhms15d22    rwhms20n12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit retrotransposon protein, putative, Ty1-copia subclass [Oryza sativa (japonica cultivar-group)]
Score 663
Evalue 1.02712e-67
Total Hit Count 354
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1935
AGCATAGATTCTCCCAGGCGGGCAGATAATTTAAAAGCTCAGACAATTAACCATTGTACCATAATAGCATTCGATCTACTTCGAAGTCTTGCATAACAAA
CACAGGGAGGGTATCATAATTCAAAACTGTAGCCAAATTCTACTACCGAACACGATTGCATAGAGGGGACTTCATCTGATCAGAATTCGGCAGGAACAGT
TCCAGCAACCTGGTCCAGATCGCGCCTTCCCTGGGAGGTGATGAGCCTTCCACCCTTGGGGTCGACATCAATGATGCCCATCTTCTGCAACTCCTGGAGG
ATGTTGCGGGAAACAGCACCACTGCTCTTGCAAAAGTGCGGTGGGCGTGAACCGTTCCTCTGACGGCCACCGTAGATCTTCTGGAAGCCGCCGATCCCGA
TTCCCTGCCTCAGGTAGATCTTCCTTGCCATCGAGGCAGCCCTGATGTAGTACCAGTCAGCATCAGAAGGTGGCAGCTCCTTGAACCTTGCAGTCTTGAC
AATGTCAACCCACTCTGGAAGCTCCATCTTGCCGGAGCGCTTGAGGTGCGCGGAGTAGGCCTTGACGAACTCGTGGGGGTTGACATCCTTCACCGTGCGC
GCGGTGGAGGCCGCGGTCTCGGCTGCGGGAGCGGGGACGGTCGCCATCCTGTGCTCTGGCCGACGGCGGCGCTGTCTTCAGGAAGGAGGGAGAGGGGTGC
GCGCCGCTG
page-top