Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1899
Contig Information
Length 585 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whms10e03    whms10e04    rwhms10e04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit geranylgeranyl hydrogenase [Triticum aestivum]
Score 619
Evalue 8.3616e-63
Total Hit Count 174
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1899
AGGGGATCTACTTCGCGGCGAAGAGCGGGCGGATGTGCGCGGAGGCGATCGTGGCCGGGTCGGCGAACGGGACGCGGCTGGTGGACGAGAGCGACCTGCG
CAAGTACCTGGCGGAGTTCGACCGGCTCTACTGGCCGACGTACAAGGTGCTGGACATCCTGCAGAAGGTGTTCTACCGCTCCAACGCGGCGCGGGAGGCG
TTCGTGGAGATGTGCGCCGACGACTACGTGCAGCGGATGACCTTCGACAGCTACCTCTACAAGCGCGTCGTGCCGGGCAACCCCATCGAGGACATCAAGC
TCGCCGTCAACACCATCGGCAGCCTCGTCAGGGCCACCGCGCTGCGCCGGGAGATGGGGAAGCTCACCTTGTGATCGCCGACCCGCCGGAAACGTTCCTG
ACAGCCTGCTTGGGTCGCTCGAAGCTGCGGCGGATCGGTCGGTATAGCAGAGATCCGCGGCTGATCGAACGGATTTGAGGCAGAGGAGATGAGAATAAGG
TAATGGCGTCGATCGAGAGGTCGTGTCTTGGTCGATCCTGTCCGGTTTTCTTGTAGTACAACGTACGCATGCACGGTGATGTTCA
page-top