Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1896
Contig Information
Length 440 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whms10a07    whms11e18    rwhms10a07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa Japonica Group] >gi|125598394|gb|EAZ38174.1| hypothetical protein OsJ_021657 [Oryza sativa (japonica cultivar-group)]
Score 90
Evalue 0.10835
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1896
GAACAATAGCAGGGCAAAGAAAGAAAGCTAGCTAACTACTTTAGTTTTCTTTATGGTGCTTATGAAGAACAGCGTGCAGGCTATGTGCTTGGTGGCTCTT
GTTATCATGTCTACCGCTTTATTGCCCACTCATGTAGAAGGAAGAATCATGGATACGAAGGAGAGGAGCCTCACATCGTGCTTTCTTTGGAAACGCTGCA
CAATCGATCTATGCCGGCAAAATTGTTCAGCACGTGGATATGCTAAGAGTGAAAGCACCTGTGATTCATACAAAGATAATAAATACTGCTGCTGCGCGAC
GGATTGAAGGATACAGCTGTGATGGATACTACACATCATATCGTCCTACATCTAAGTATTTCTTGCAAATAGCAAATAATGACTACCGATGGAATTGATG
TAGCAGATTCAATAAACTTTAAATTTTACTAAAAAAAAAA
page-top