Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1768
Contig Information
Length 1336 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whms4j03    whms20e14    rwhms4j03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1614
Evalue 1.55768e-177
Total Hit Count 95
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1768
CTTTCTCCTTCTGTCCCGCAAACCCCCGAGAGATCACAGCATGTTCGGCTTCGGTCACCACGGCCACCATGGCCAGAACCCCCCGGCCCACGCTCCGGCC
GCCGCCGGAGGCAACCAGCCCACCTTCAAGATCTTCTGCAAGGCCGACGAGGGCTACTGCCTCTCCGTCCGTGACGGCAACGTCGTCCTCGCCCCGTCCA
ACCCCCGTGACGAGCACCAGCACTGGTTCAAGGACATGCGCTTCAGCGCCCAGATCAAGGACGAGGAGGGTAACCCCGCCTTCGCCATCGTCAACAAGGC
CACTGGCCTCGCCGTCAAGCACTCGCTCGGCCAGTCCCACCCGGTGAAGCTCGTGCCATTCAACCCGGAGTACCTCGACGAGTCCGTGATGTGGACGGAG
AGCGGCGACGTCGGCAAGGGCTTCCGCTGCATTCGCATGGTGAACAACATCCGCCTCAACTTCGACGCCCTCAACGGTGACAAGGACCACGGCGGCGTGC
ACGACGGCACCACCGTCGTTCTCTGGGAGTGGGCCAAGGGCGACAACCAGAGCTGGAAGATCCTCCCCTGGGGCGAAGAGGCCTACGCCGGAGGCAGCGC
CAACGCCCCCCGCGGCGGCTCCTCAGAGCCCACCGTGCGCATCTTCTGCAAGGCCGACGACGGCTTCAGCGCCACCGTCCGCAACGGCACTGTGGTCCTC
GCGCCCACCAACCCCCGCGACGAGTACCAGCACTGGTTCAAGGACATGAGGCACAGCAACCGCATCAAGGATGAGGAAGGCTACCCGGCCTTCGCCCTCG
TCAACAAGGTGACAGGCGAGGCCATCAAGCACTCCCAAGGCGAGGGCCACCCTGTGAAGCTGGTGCCATACAACGCCAACTACCAGGACGAGTCAGTGTT
GTGGACTGAGAGCCGCGACGTGGGCGCCGGCTTCCGGTGCATCCGCATGGTGAACAACATCTACCTCAACTTTGACGCTCTCCACGGCGACAAGGAGCAC
GGCGGCGTTCGCGACGGCACCTCCCTCGTGCTGTGGAAGTGGTGCGAGGGCGACAACCAGCGCTGGAAGATCCTCCCCTGGTAAACGTGTCATGCTGCTG
AAGCTGAGTTGATCGCCACCGTGACCCGGAGTTGGTAGAGATCGGCCTGTGATCTGTTGCCGCGTCGGTAGAATAAAAGTCGTGTGCGGTCGGCGGTGGT
GATGTGTCCGTGAGTGTGTGTGTTTAGTTTCTGTCCTGTCGTTGTGTCCTGCTATGGCGAGCTATCCGATGTAATAAGCATTTGGCACTTGTGCTTGTTT
TTCAAAACCATGGATCCGTGATGAGAACCCTCTGTA
page-top