Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1705
Contig Information
Length 857 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whms10b18    rwhms10b18    rwhms12l10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit casein kinase II beta [Hordeum vulgare]
Score 1053
Evalue 8.8972e-113
Total Hit Count 404
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1705
ACCCTGGCTAACATGCAAATGTGCATAGATTGATCAAGTGAGGAAACCTAGATTACACAAGAGTCATACAACAAAACAGATACAGTTGCTCAGCAGTTTA
CAGCAAGATTCGAGCTCGCGAGTACTCGAATCAAGAGGCCACAACATTTTCAGGCCAAGGTGTTCCATCTCTAACACTAGGTAAAAACAAATAGCGCCCG
CTGGTAAAAGTTCGTCATGACTGCTTGTGAAGTTTGAAGCCAAAAACCCTTGGGACGTATTGCTGTGATGGCTTCTGTGGTTTCAGGTGTGGGTATGTCA
TCAAGAAGAGATGAGGGAATGTCGTACCAAAGTATGCTCCATCAATGTTGCCTTGGTACTTGGACCTTGGATAGTGTAAATCTTCACATTTTGGACAAAA
CACCTTCACTGTGCTTGACCTAGGAATGTCTGATTGCCCTGCTGGAAGACAGGGTTGACCACAGCAGTATACACGAGGGCATCTGCCAAAATCATAGTTC
TTGAACTTTTCTAACATTGCAGCTAGACCCTTGCTGGTTAAGATGTACCGTGCATGAATTAAACCATACAGCATCTCTGCAGATGACTCGATTAATTCAT
TTTGCTCCTCAGTGAATACATCACCATTAGAAGACTCGATGTCTAGGATGAGATCAAGTGCATAATCATAATATGGCACCTGACTGCTTAGGCCACAGAG
ATTGAAATCATCCTGTATATAATCATCATCAATCTCACAGAAGAATTCGTTGCCTCGCAAGCTACAGAACCATGAAATCCAAGATGTGTCCTCTCCTTCA
GAACCACTAACATCAGAATCTTCACTATCAGTTTCAAATTCCTCGACGTCGGAGACC
page-top