Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1703
Contig Information
Length 1089 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 3 Clones [Download: CSV  ,  FASTA ]
whms10b11    rwhms10b11    rwhms4e12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0614400 [Oryza sativa (japonica cultivar-group)] >gi|77552020|gb|ABA94817.1| Patatin-like phospholipase family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113645490|dbj|BAF28631.1| Os11g0614400 [Oryza sativa (japonica cultivar-group)] >gi|125577199|gb|EAZ18421.1| hypothetical protein OsJ_032630 [Oryza sativa (japonica cultivar-group)] >gi|215765027|dbj|BAG86724.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1097
Evalue 1.0309e-117
Total Hit Count 435
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1703
CACACTCAGATTTTATTTAAAAATAATAATTACCCACCCACATTACATTATATTACAACTCTCGACCTAGCTATAGCATAGCTAGGGATGCAAATGGACA
GCGTCGACGTTTGTCCATGAAAGCATAATTAAAACATGCACGGTTATTAAAATAACAAAGATTATCGGCCGTTTGCATCCTTAAGCATAGCAGCTAGCTA
GTGCTTCTTCGTCTCTCTTCTCTTTCGCTCAAATCGTCCTCTTCTCTATTTGGAGTTGAGGTTGGTTTGGCGCAGCTTGCGCTCCTCAGAGAGCTTCCTG
GCGAAGCGCGTGAGGGCCTCTTCGTTGGTGCCCTCACCTTCGACGGATTCATACATCCCTGTGTCAATGTTCACCCGGGACACATTCTTCTTGAGCAGAT
TCTTACCGATCCCGATAAGCGCCTCCATGTTCTCTTTGGTGGCGATATCGACCGAGGATGTGTGCCCCGTGAGCGAGTCGTCCTGGATGCGTAGGTAGTT
CTTCTCAATGCGGAGGGCCTGAAACAGCACGGCAGCGTGGATGTCGACCATGTCGGCGCTCGCATGGGAGAAGATGTCGATGAGCGGGGTGAAGCCGCCG
TCATAGAGCCATCGAAGGACGCCCCACTTGGCGCAGTCGGGCGCGGTGTACTTCTCCGCCATCTTGGCGGACCCCGTGCCGATGGAGATGATGAGGTAGT
TGCCGTACTCGGCGGGCTTGCCGTGCGTGAAGTCGGGGTTGCGGCGCAACACCTCCTTGGTGATCATGGACATGGCGGCCATGGTGGGGTTGTTGGCGGC
CACGCCGCCGTCGATGAGGTGGTACTCGCGGTCCGGCAGCTTGCCCGCGGGGTCGCGGGTGGTGAAGTAGTGCGCGGGGAAGTAGGTGGGCGCGGCCGAT
GTGCTGATGCAGATGTCGGAGAGGTGCGCGTTCTTGAGCGGGTCCACCTTGGCCTCGTACGTGTTGAAGATGATCGGCTGCAGGTACTTGACGTCGAACG
TCGGGACGATGATGTTGGTGACGGTGTCGGCGACGGTGACGTCGTTGGTGAGGTTCTTGATCTTGTCGTGCAGGAACTTACCGTCGTAC
page-top