Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1688
Contig Information
Length 792 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
rwhms10c03    rwhms19p11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_13812 [Oryza sativa Indica Group]
Score 209
Evalue 5.67708e-15
Total Hit Count 11
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1688
CATTTCAGAATTTTTATTGTACAAAAAATAGTCCCAGAAAATGTGAGTCCATACTTGCTCTTAGCTACAAATACAACAGTACAAGCTATGGTAACCTCCA
GGACTAGAGGCACCAGCTGACCAGCACATACATATCCAAGCACTAGCTAGATCTCATCTCATGAGATGAGCATTTGACTGCATACCTATATGGCTAAGAA
ATAAATGCAAATTGCTCCAATGGACCTTCCAGAATCTAAGGCCGTCGTCGCATGCTTCAAACCTTGACGACGGTAGATAGGGCTTCAGATGGCTTGTCAA
GCCTGCAGCTCAACTCTCTTGAACAACAGATCAACGGAACCGGCACGGCGATGCTTCCCTTCCAGCGCTGGGGAGTCTTCGGTAGCCTTGGGGGATCGGC
TCACCGCAGGTTTATTCACTTGCCGTTTGCCAGTTTCTGTGCCAGTGCCAGGCAAGGAGAACCTCTTGTTGGCCCGTGGTTGTAACTGTCCAGGCCTCTC
CTTAGGATTACTACTGCTCCGGACACCAAGTCCCGAAAGACGAGACGAGACTTCATCAGAACCTTCTTTCGGTGGCAGCTTCCGTTTCGGTTTAGCTGAC
GCCGAACCGGCAGACGGGTTCGACGAGGAGCCACCACCCTCTGAGTTCGAGGGCCGGGCCTTCTGGATCAACACATTTGAATGAAGAGCTGAAACCTGCT
TTTTCACCAGGTTTCCTGTATGGGGCCTTGGTTGCATTTCCCTCAGCGTGCTGCGCTCCGGTATCGATGGCAATTCCAATCCTGCTGCGTAC
page-top