Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_MS_all.Contig1661
Contig Information
Length 507 bp
Tissue Seed DPA5 of DT3DL CS wheat
Clones 2 Clones [Download: CSV  ,  FASTA ]
whms19p19    rwhms13p06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit papain-like cysteine proteinase [Hordeum vulgare subsp. vulgare]
Score 736
Evalue 1.49717e-76
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_MS_all.Contig1661
ACGAAGCCTTTGTCGCCCCACTGGTCATTCCACGAGTTCTTGCCAATCCAGTACTTGGTCCCGTCAGGCTTGGTCCCGTACCCGACGATGGCCAGCGCGT
GGTTCTGCGTTGTCCCGCACGCCCCTTTGTTGTACACGCCCGACCTGGAGCAACCGGCGTTGTACACGCCGCGGATGTAGTGCTGGAAGCAGGGGTCACT
GTAGTCGAAGGATGCGGCGACGGGCTGCTGCGCCACGGCCGCCATCAGCGCCGCCTCGTCACCGGGTGGTGAAATCTTCTTGTAGCCTCTGAGCTTCACC
GCGACCGGCTTGGCCCTTTGGCACGTGCCCACCTTGCCGGTGTAGGGGTAGGCCGCCTCCGTGGTGATGCCACCGTTCTGGATCACCCACTCNAAGGCCT
TGTCCATCCAACTGTTGCCGCANCCGTTAATCCGACAGTCCACCANCTGCTGCTCCNACAGCACCGGTGGCGATCCGCCCGTGCTGATCGCATGCGCNCT
CTCCATC
page-top